FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624674_at:

>probe:Drosophila_2:1624674_at:673:577; Interrogation_Position=544; Antisense; GGCCGATCCTAAGGTGAGAAGTGTA
>probe:Drosophila_2:1624674_at:130:257; Interrogation_Position=561; Antisense; GAAGTGTAGGGTGTATATTGTTTTA
>probe:Drosophila_2:1624674_at:578:475; Interrogation_Position=580; Antisense; GTTTTAAACACAAGCAAATCCAAGT
>probe:Drosophila_2:1624674_at:729:355; Interrogation_Position=593; Antisense; GCAAATCCAAGTATCAGGGAGTAGT
>probe:Drosophila_2:1624674_at:132:493; Interrogation_Position=624; Antisense; GTAAGCAACTAGGAAATTCTCTATC
>probe:Drosophila_2:1624674_at:594:559; Interrogation_Position=635; Antisense; GGAAATTCTCTATCTAGCTTTGTTA
>probe:Drosophila_2:1624674_at:538:643; Interrogation_Position=641; Antisense; TCTCTATCTAGCTTTGTTACTCATT
>probe:Drosophila_2:1624674_at:354:475; Interrogation_Position=656; Antisense; GTTACTCATTTATGCTAGCTAAACA
>probe:Drosophila_2:1624674_at:97:191; Interrogation_Position=677; Antisense; AACATACATATAGCTCTATACCATA
>probe:Drosophila_2:1624674_at:585:33; Interrogation_Position=708; Antisense; ATCAAGATTAAAGCTCTTGCTACGG
>probe:Drosophila_2:1624674_at:164:337; Interrogation_Position=720; Antisense; GCTCTTGCTACGGATATGGTTTGTT
>probe:Drosophila_2:1624674_at:710:679; Interrogation_Position=734; Antisense; TATGGTTTGTTGAATCACGAGCAAT
>probe:Drosophila_2:1624674_at:66:279; Interrogation_Position=759; Antisense; CTATGAGTACATACATTTTGGCATG
>probe:Drosophila_2:1624674_at:513:21; Interrogation_Position=796; Antisense; ATATTTATTTAGGTATGCTGCGACT

Paste this into a BLAST search page for me
GGCCGATCCTAAGGTGAGAAGTGTAGAAGTGTAGGGTGTATATTGTTTTAGTTTTAAACACAAGCAAATCCAAGTGCAAATCCAAGTATCAGGGAGTAGTGTAAGCAACTAGGAAATTCTCTATCGGAAATTCTCTATCTAGCTTTGTTATCTCTATCTAGCTTTGTTACTCATTGTTACTCATTTATGCTAGCTAAACAAACATACATATAGCTCTATACCATAATCAAGATTAAAGCTCTTGCTACGGGCTCTTGCTACGGATATGGTTTGTTTATGGTTTGTTGAATCACGAGCAATCTATGAGTACATACATTTTGGCATGATATTTATTTAGGTATGCTGCGACT

Full Affymetrix probeset data:

Annotations for 1624674_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720