Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624675_at:

>probe:Drosophila_2:1624675_at:692:41; Interrogation_Position=1049; Antisense; ATCGTTGCGCTACCAGGGAAAGCCC
>probe:Drosophila_2:1624675_at:212:393; Interrogation_Position=1066; Antisense; GAAAGCCCCATCATCAGCTGAGCAA
>probe:Drosophila_2:1624675_at:474:439; Interrogation_Position=1140; Antisense; GATGGTTGCGGATCCGGAATCCTTA
>probe:Drosophila_2:1624675_at:500:365; Interrogation_Position=1156; Antisense; GAATCCTTAGCCCATCGGAGGTCGC
>probe:Drosophila_2:1624675_at:49:165; Interrogation_Position=1269; Antisense; AAAATTAACCTACGCCTCATTCTTG
>probe:Drosophila_2:1624675_at:547:687; Interrogation_Position=1316; Antisense; TATTTTTAGCCCTTCAGATTCCGCA
>probe:Drosophila_2:1624675_at:646:463; Interrogation_Position=1332; Antisense; GATTCCGCAGGTGATATTGCACAAA
>probe:Drosophila_2:1624675_at:308:465; Interrogation_Position=1380; Antisense; GATTGGACCCACGAAACTGTGTCGA
>probe:Drosophila_2:1624675_at:223:515; Interrogation_Position=1398; Antisense; GTGTCGAAAGCCGAAATCTTGCGCT
>probe:Drosophila_2:1624675_at:721:417; Interrogation_Position=1465; Antisense; GAGCACTGGGACTTCCATTAGGCAA
>probe:Drosophila_2:1624675_at:252:679; Interrogation_Position=1507; Antisense; TAGTGCCACGTGATAATTTGCCAGA
>probe:Drosophila_2:1624675_at:203:721; Interrogation_Position=1524; Antisense; TTGCCAGAGCCCAATTCACAAGATC
>probe:Drosophila_2:1624675_at:249:227; Interrogation_Position=1564; Antisense; AAGGCGGTTCTGGACGATGCTGTTC
>probe:Drosophila_2:1624675_at:276:447; Interrogation_Position=1579; Antisense; GATGCTGTTCGACAAATTGCTCTAT

Paste this into a BLAST search page for me
ATCGTTGCGCTACCAGGGAAAGCCCGAAAGCCCCATCATCAGCTGAGCAAGATGGTTGCGGATCCGGAATCCTTAGAATCCTTAGCCCATCGGAGGTCGCAAAATTAACCTACGCCTCATTCTTGTATTTTTAGCCCTTCAGATTCCGCAGATTCCGCAGGTGATATTGCACAAAGATTGGACCCACGAAACTGTGTCGAGTGTCGAAAGCCGAAATCTTGCGCTGAGCACTGGGACTTCCATTAGGCAATAGTGCCACGTGATAATTTGCCAGATTGCCAGAGCCCAATTCACAAGATCAAGGCGGTTCTGGACGATGCTGTTCGATGCTGTTCGACAAATTGCTCTAT

Full Affymetrix probeset data:

Annotations for 1624675_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime