Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624677_at:

>probe:Drosophila_2:1624677_at:355:515; Interrogation_Position=7837; Antisense; TTTGGACCCGGAACATGCCGTTACG
>probe:Drosophila_2:1624677_at:280:207; Interrogation_Position=7867; Antisense; AAGCTGTACGTGTCCGCCCAGCAGA
>probe:Drosophila_2:1624677_at:234:115; Interrogation_Position=7886; Antisense; AGCAGATTCCACGTGACGATCCCTG
>probe:Drosophila_2:1624677_at:629:715; Interrogation_Position=7915; Antisense; TTCTGCTTCTGCTTCCGAAGCGACA
>probe:Drosophila_2:1624677_at:387:377; Interrogation_Position=7931; Antisense; GAAGCGACATCATCTGCCTGCAGCA
>probe:Drosophila_2:1624677_at:454:69; Interrogation_Position=8038; Antisense; ATGGCCGCCGTGCTGAACATCACCA
>probe:Drosophila_2:1624677_at:575:719; Interrogation_Position=8101; Antisense; TTCCTGCACTATTCGCACGGCGAGG
>probe:Drosophila_2:1624677_at:488:335; Interrogation_Position=8141; Antisense; GCTGCCTGATCAACGGCCGTTCATA
>probe:Drosophila_2:1624677_at:489:471; Interrogation_Position=8159; Antisense; GTTCATACCGCGTGGGCGAGCAAAT
>probe:Drosophila_2:1624677_at:558:421; Interrogation_Position=8176; Antisense; GAGCAAATCGAGTCCACGAGCGGTC
>probe:Drosophila_2:1624677_at:597:137; Interrogation_Position=8191; Antisense; ACGAGCGGTCCCTGCATTAGCTGCA
>probe:Drosophila_2:1624677_at:635:273; Interrogation_Position=8205; Antisense; CATTAGCTGCACTTGCGGTGGAGAC
>probe:Drosophila_2:1624677_at:679:445; Interrogation_Position=8235; Antisense; GATGAAGTGTGATCCCCAGCAGTGC
>probe:Drosophila_2:1624677_at:694:305; Interrogation_Position=8273; Antisense; CCATGCAGCAGGTGATGGCCGCCGT

Paste this into a BLAST search page for me
TTTGGACCCGGAACATGCCGTTACGAAGCTGTACGTGTCCGCCCAGCAGAAGCAGATTCCACGTGACGATCCCTGTTCTGCTTCTGCTTCCGAAGCGACAGAAGCGACATCATCTGCCTGCAGCAATGGCCGCCGTGCTGAACATCACCATTCCTGCACTATTCGCACGGCGAGGGCTGCCTGATCAACGGCCGTTCATAGTTCATACCGCGTGGGCGAGCAAATGAGCAAATCGAGTCCACGAGCGGTCACGAGCGGTCCCTGCATTAGCTGCACATTAGCTGCACTTGCGGTGGAGACGATGAAGTGTGATCCCCAGCAGTGCCCATGCAGCAGGTGATGGCCGCCGT

Full Affymetrix probeset data:

Annotations for 1624677_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime