FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624678_at:

>probe:Drosophila_2:1624678_at:498:317; Interrogation_Position=1076; Antisense; GCCTGGATGCGCGTCAATTGACAAA
>probe:Drosophila_2:1624678_at:534:161; Interrogation_Position=1098; Antisense; AAATTGTCGGCTCGACTGGCCCATT
>probe:Drosophila_2:1624678_at:153:679; Interrogation_Position=1151; Antisense; TAGGCTTGCTCTCAACTTCCCAAAA
>probe:Drosophila_2:1624678_at:591:309; Interrogation_Position=1195; Antisense; GCCAAAAATACAATCCCGGGCAATT
>probe:Drosophila_2:1624678_at:496:525; Interrogation_Position=1212; Antisense; GGGCAATTTTAGACCCAAACAGAGC
>probe:Drosophila_2:1624678_at:288:609; Interrogation_Position=708; Antisense; TGAGCAGCCTGCTCCAGAGCCAGAG
>probe:Drosophila_2:1624678_at:67:423; Interrogation_Position=766; Antisense; GAGAATCATCTAAAGCTGCTGGCCA
>probe:Drosophila_2:1624678_at:400:133; Interrogation_Position=796; Antisense; ACTGATTGCTAACCCCTTGTCGTCG
>probe:Drosophila_2:1624678_at:381:171; Interrogation_Position=847; Antisense; AAAGACTTCGCAAAGCGGCCTCAAT
>probe:Drosophila_2:1624678_at:31:207; Interrogation_Position=859; Antisense; AAGCGGCCTCAATTAGACGAACGAT
>probe:Drosophila_2:1624678_at:257:105; Interrogation_Position=873; Antisense; AGACGAACGATCATGCCGGGACCAG
>probe:Drosophila_2:1624678_at:659:317; Interrogation_Position=887; Antisense; GCCGGGACCAGACCAGACGAAGCAA
>probe:Drosophila_2:1624678_at:65:359; Interrogation_Position=908; Antisense; GCAAATGTATTTATTCCAGCCAGAT
>probe:Drosophila_2:1624678_at:10:313; Interrogation_Position=926; Antisense; GCCAGATGGACTCGAAAGGCTCTAA

Paste this into a BLAST search page for me
GCCTGGATGCGCGTCAATTGACAAAAAATTGTCGGCTCGACTGGCCCATTTAGGCTTGCTCTCAACTTCCCAAAAGCCAAAAATACAATCCCGGGCAATTGGGCAATTTTAGACCCAAACAGAGCTGAGCAGCCTGCTCCAGAGCCAGAGGAGAATCATCTAAAGCTGCTGGCCAACTGATTGCTAACCCCTTGTCGTCGAAAGACTTCGCAAAGCGGCCTCAATAAGCGGCCTCAATTAGACGAACGATAGACGAACGATCATGCCGGGACCAGGCCGGGACCAGACCAGACGAAGCAAGCAAATGTATTTATTCCAGCCAGATGCCAGATGGACTCGAAAGGCTCTAA

Full Affymetrix probeset data:

Annotations for 1624678_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720