Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624679_at:

>probe:Drosophila_2:1624679_at:143:129; Interrogation_Position=1230; Antisense; ACCAGTGACGCTCGATGTCGGTGCT
>probe:Drosophila_2:1624679_at:604:61; Interrogation_Position=1244; Antisense; ATGTCGGTGCTGCAACCATATCTGG
>probe:Drosophila_2:1624679_at:650:359; Interrogation_Position=1255; Antisense; GCAACCATATCTGGAGGCACTGCAT
>probe:Drosophila_2:1624679_at:264:325; Interrogation_Position=1284; Antisense; GCGAGCTGCAGCGTCAGCAGAAGCA
>probe:Drosophila_2:1624679_at:388:401; Interrogation_Position=1355; Antisense; GACATCGTGGGTTTCTTGCTCTAGT
>probe:Drosophila_2:1624679_at:704:711; Interrogation_Position=1367; Antisense; TTCTTGCTCTAGTGGAACGGCGGCA
>probe:Drosophila_2:1624679_at:282:567; Interrogation_Position=1388; Antisense; GGCAGCAGCGACAGAAAGCGGAACT
>probe:Drosophila_2:1624679_at:388:57; Interrogation_Position=1431; Antisense; ATGAGTCACCAATGAATTCGAATGA
>probe:Drosophila_2:1624679_at:657:393; Interrogation_Position=1454; Antisense; GAAAGTGCCATGGAATTCCCTAGAT
>probe:Drosophila_2:1624679_at:703:563; Interrogation_Position=1465; Antisense; GGAATTCCCTAGATTCTGGAGAGAT
>probe:Drosophila_2:1624679_at:373:401; Interrogation_Position=1485; Antisense; GAGATTCAAACATGGTTCGGACTTA
>probe:Drosophila_2:1624679_at:399:491; Interrogation_Position=1567; Antisense; GTAACTGAGGCTTTTCCAAGGCTTT
>probe:Drosophila_2:1624679_at:70:225; Interrogation_Position=1584; Antisense; AAGGCTTTTCCTTCTTCATTCACAG
>probe:Drosophila_2:1624679_at:560:627; Interrogation_Position=1592; Antisense; TCCTTCTTCATTCACAGTCGTTTTA

Paste this into a BLAST search page for me
ACCAGTGACGCTCGATGTCGGTGCTATGTCGGTGCTGCAACCATATCTGGGCAACCATATCTGGAGGCACTGCATGCGAGCTGCAGCGTCAGCAGAAGCAGACATCGTGGGTTTCTTGCTCTAGTTTCTTGCTCTAGTGGAACGGCGGCAGGCAGCAGCGACAGAAAGCGGAACTATGAGTCACCAATGAATTCGAATGAGAAAGTGCCATGGAATTCCCTAGATGGAATTCCCTAGATTCTGGAGAGATGAGATTCAAACATGGTTCGGACTTAGTAACTGAGGCTTTTCCAAGGCTTTAAGGCTTTTCCTTCTTCATTCACAGTCCTTCTTCATTCACAGTCGTTTTA

Full Affymetrix probeset data:

Annotations for 1624679_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime