FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624683_at:

>probe:Drosophila_2:1624683_at:257:127; Interrogation_Position=114; Antisense; AGCCTACCAAGATGATTGTCCCACG
>probe:Drosophila_2:1624683_at:466:31; Interrogation_Position=201; Antisense; ATAACCTAAGGATCCTGCAGCGCCA
>probe:Drosophila_2:1624683_at:434:61; Interrogation_Position=227; Antisense; ATGTCCAGCGTGTACTTTCGCAGTG
>probe:Drosophila_2:1624683_at:483:693; Interrogation_Position=242; Antisense; TTTCGCAGTGGAGCCATCAAACCCA
>probe:Drosophila_2:1624683_at:624:197; Interrogation_Position=350; Antisense; AACGTGGCCAACTTTCTGGAGGAGA
>probe:Drosophila_2:1624683_at:678:75; Interrogation_Position=369; Antisense; AGGAGAACGATCTGTTCGTGCCCGC
>probe:Drosophila_2:1624683_at:11:209; Interrogation_Position=417; Antisense; AAGCATCCGGACACTTGACAATCTC
>probe:Drosophila_2:1624683_at:436:549; Interrogation_Position=448; Antisense; GGAGTGCCTCCTAGTCGGGATAAAT
>probe:Drosophila_2:1624683_at:444:391; Interrogation_Position=505; Antisense; GAAACCAGCTCACGGCCATATATTT
>probe:Drosophila_2:1624683_at:26:23; Interrogation_Position=524; Antisense; ATATTTGTTCATCCATTAGCCTCCT
>probe:Drosophila_2:1624683_at:172:13; Interrogation_Position=538; Antisense; ATTAGCCTCCTTTTTCTACATACAT
>probe:Drosophila_2:1624683_at:6:325; Interrogation_Position=575; Antisense; GCGCAGCTCTTGCATTTTTTGTGTA
>probe:Drosophila_2:1624683_at:507:3; Interrogation_Position=599; Antisense; ATTGTCGTGTATTCTTCAAGTCCCG
>probe:Drosophila_2:1624683_at:456:213; Interrogation_Position=616; Antisense; AAGTCCCGCTTTGATATTTTCGCTT

Paste this into a BLAST search page for me
AGCCTACCAAGATGATTGTCCCACGATAACCTAAGGATCCTGCAGCGCCAATGTCCAGCGTGTACTTTCGCAGTGTTTCGCAGTGGAGCCATCAAACCCAAACGTGGCCAACTTTCTGGAGGAGAAGGAGAACGATCTGTTCGTGCCCGCAAGCATCCGGACACTTGACAATCTCGGAGTGCCTCCTAGTCGGGATAAATGAAACCAGCTCACGGCCATATATTTATATTTGTTCATCCATTAGCCTCCTATTAGCCTCCTTTTTCTACATACATGCGCAGCTCTTGCATTTTTTGTGTAATTGTCGTGTATTCTTCAAGTCCCGAAGTCCCGCTTTGATATTTTCGCTT

Full Affymetrix probeset data:

Annotations for 1624683_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720