Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624685_at:

>probe:Drosophila_2:1624685_at:592:353; Interrogation_Position=1286; Antisense; GCACTACCAGCATCCTGACCAAGTA
>probe:Drosophila_2:1624685_at:690:609; Interrogation_Position=1301; Antisense; TGACCAAGTACACGCCCAGCAGCAA
>probe:Drosophila_2:1624685_at:206:489; Interrogation_Position=1379; Antisense; GTACGGAAACGGACAGCAGCCTGTG
>probe:Drosophila_2:1624685_at:252:597; Interrogation_Position=1400; Antisense; TGTGCAGCTGCAACCCAACCAGGTT
>probe:Drosophila_2:1624685_at:284:253; Interrogation_Position=1415; Antisense; CAACCAGGTTTACCAACACGCTGGA
>probe:Drosophila_2:1624685_at:593:155; Interrogation_Position=1430; Antisense; ACACGCTGGACAGATTCCGCAGCAA
>probe:Drosophila_2:1624685_at:674:239; Interrogation_Position=1473; Antisense; AATCAACCTGTGTATCAGCAACAGC
>probe:Drosophila_2:1624685_at:498:173; Interrogation_Position=1538; Antisense; AAAGCCTGTGCAACAGCCGGTGCAA
>probe:Drosophila_2:1624685_at:261:359; Interrogation_Position=1706; Antisense; GCAACCCGTAGCACAACAACAGATC
>probe:Drosophila_2:1624685_at:394:189; Interrogation_Position=1723; Antisense; AACAGATCCACAATCAGAGTCCTCC
>probe:Drosophila_2:1624685_at:502:631; Interrogation_Position=1745; Antisense; TCCGCCCGTTCTGAATCAACAGGTG
>probe:Drosophila_2:1624685_at:72:367; Interrogation_Position=1757; Antisense; GAATCAACAGGTGCCAGTGCAGCAG
>probe:Drosophila_2:1624685_at:427:651; Interrogation_Position=1811; Antisense; TCAACAACACTAAGCATTCCCTTGC
>probe:Drosophila_2:1624685_at:256:659; Interrogation_Position=1821; Antisense; TAAGCATTCCCTTGCTAACGCATTT

Paste this into a BLAST search page for me
GCACTACCAGCATCCTGACCAAGTATGACCAAGTACACGCCCAGCAGCAAGTACGGAAACGGACAGCAGCCTGTGTGTGCAGCTGCAACCCAACCAGGTTCAACCAGGTTTACCAACACGCTGGAACACGCTGGACAGATTCCGCAGCAAAATCAACCTGTGTATCAGCAACAGCAAAGCCTGTGCAACAGCCGGTGCAAGCAACCCGTAGCACAACAACAGATCAACAGATCCACAATCAGAGTCCTCCTCCGCCCGTTCTGAATCAACAGGTGGAATCAACAGGTGCCAGTGCAGCAGTCAACAACACTAAGCATTCCCTTGCTAAGCATTCCCTTGCTAACGCATTT

Full Affymetrix probeset data:

Annotations for 1624685_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime