Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624687_a_at:

>probe:Drosophila_2:1624687_a_at:392:215; Interrogation_Position=395; Antisense; AAGTTCACAAGGTGGCTGCGACTTT
>probe:Drosophila_2:1624687_a_at:465:649; Interrogation_Position=419; Antisense; TAACCCACCCGGTTAATGGTGATGA
>probe:Drosophila_2:1624687_a_at:640:615; Interrogation_Position=522; Antisense; TGAATCCTACTTGGCGCCCTTTGAA
>probe:Drosophila_2:1624687_a_at:582:313; Interrogation_Position=537; Antisense; GCCCTTTGAACGAGCCCTGGTGAAA
>probe:Drosophila_2:1624687_a_at:608:413; Interrogation_Position=548; Antisense; GAGCCCTGGTGAAAGTGCGCAACTT
>probe:Drosophila_2:1624687_a_at:155:641; Interrogation_Position=572; Antisense; TCTGCGACGCCCTGAGAAGCGTGAT
>probe:Drosophila_2:1624687_a_at:352:133; Interrogation_Position=674; Antisense; ACCCACCAGGTGCAACTTCAAAGGA
>probe:Drosophila_2:1624687_a_at:659:223; Interrogation_Position=694; Antisense; AAGGAGCTCCGGGTTCAAGGTCGCT
>probe:Drosophila_2:1624687_a_at:554:251; Interrogation_Position=709; Antisense; CAAGGTCGCTTTCAACGCCTGGCAT
>probe:Drosophila_2:1624687_a_at:415:43; Interrogation_Position=741; Antisense; ATCCGAGGGCCGCAAGCTCAAGAAA
>probe:Drosophila_2:1624687_a_at:687:603; Interrogation_Position=803; Antisense; TGATTGCCTACAAGCTCAAGTTCCT
>probe:Drosophila_2:1624687_a_at:624:653; Interrogation_Position=845; Antisense; TAATCGGCGGACTCACGCTGCTCGT
>probe:Drosophila_2:1624687_a_at:259:719; Interrogation_Position=898; Antisense; TTCGCTCTCTTTACGGCTGTAATGA
>probe:Drosophila_2:1624687_a_at:216:87; Interrogation_Position=959; Antisense; AGTCCCTCGTCTTGAAGAAGCTCTG

Paste this into a BLAST search page for me
AAGTTCACAAGGTGGCTGCGACTTTTAACCCACCCGGTTAATGGTGATGATGAATCCTACTTGGCGCCCTTTGAAGCCCTTTGAACGAGCCCTGGTGAAAGAGCCCTGGTGAAAGTGCGCAACTTTCTGCGACGCCCTGAGAAGCGTGATACCCACCAGGTGCAACTTCAAAGGAAAGGAGCTCCGGGTTCAAGGTCGCTCAAGGTCGCTTTCAACGCCTGGCATATCCGAGGGCCGCAAGCTCAAGAAATGATTGCCTACAAGCTCAAGTTCCTTAATCGGCGGACTCACGCTGCTCGTTTCGCTCTCTTTACGGCTGTAATGAAGTCCCTCGTCTTGAAGAAGCTCTG

Full Affymetrix probeset data:

Annotations for 1624687_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime