FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624688_at:

>probe:Drosophila_2:1624688_at:52:507; Interrogation_Position=451; Antisense; GTGCCATTCTGGATACCAATGTCCT
>probe:Drosophila_2:1624688_at:417:229; Interrogation_Position=468; Antisense; AATGTCCTGGGCGTTTCGTGGTGCA
>probe:Drosophila_2:1624688_at:285:133; Interrogation_Position=492; Antisense; ACCCGCGAGGCTTTCAAATCACTGA
>probe:Drosophila_2:1624688_at:338:35; Interrogation_Position=594; Antisense; ATCACCATGGGCATGTATTCGCCAT
>probe:Drosophila_2:1624688_at:192:11; Interrogation_Position=610; Antisense; ATTCGCCATCGAAGTACGCAGTCAC
>probe:Drosophila_2:1624688_at:229:81; Interrogation_Position=646; Antisense; AGGTGCTGCGTCAGGAGTTCCACAA
>probe:Drosophila_2:1624688_at:449:251; Interrogation_Position=686; Antisense; CAAGATTACGAGCATCAGTCCCGGT
>probe:Drosophila_2:1624688_at:155:507; Interrogation_Position=709; Antisense; GTGCCGTGGACACCGAGATCATCGA
>probe:Drosophila_2:1624688_at:267:397; Interrogation_Position=732; Antisense; GACAAGGAGGCTCTCGTTGGCATTC
>probe:Drosophila_2:1624688_at:216:233; Interrogation_Position=767; Antisense; AATGCTCCGCTCTGAGGATGTGGCC
>probe:Drosophila_2:1624688_at:205:523; Interrogation_Position=786; Antisense; GTGGCCGATGCCATTAGCTACTGCA
>probe:Drosophila_2:1624688_at:128:299; Interrogation_Position=820; Antisense; CGCCAAATGTCCAGATTCACGAGCT
>probe:Drosophila_2:1624688_at:449:677; Interrogation_Position=873; Antisense; TAGACTCTAGATTTCCCACTGGATG
>probe:Drosophila_2:1624688_at:131:447; Interrogation_Position=894; Antisense; GATGCTTCTGCTATTTGTGTTTACA

Paste this into a BLAST search page for me
GTGCCATTCTGGATACCAATGTCCTAATGTCCTGGGCGTTTCGTGGTGCAACCCGCGAGGCTTTCAAATCACTGAATCACCATGGGCATGTATTCGCCATATTCGCCATCGAAGTACGCAGTCACAGGTGCTGCGTCAGGAGTTCCACAACAAGATTACGAGCATCAGTCCCGGTGTGCCGTGGACACCGAGATCATCGAGACAAGGAGGCTCTCGTTGGCATTCAATGCTCCGCTCTGAGGATGTGGCCGTGGCCGATGCCATTAGCTACTGCACGCCAAATGTCCAGATTCACGAGCTTAGACTCTAGATTTCCCACTGGATGGATGCTTCTGCTATTTGTGTTTACA

Full Affymetrix probeset data:

Annotations for 1624688_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720