FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624690_at:

>probe:Drosophila_2:1624690_at:203:339; Interrogation_Position=13; Antisense; GCTCACACTCACACGTTTACGAATT
>probe:Drosophila_2:1624690_at:379:553; Interrogation_Position=132; Antisense; GGAGCTTGCTACTCAGCGGTATCAA
>probe:Drosophila_2:1624690_at:303:181; Interrogation_Position=181; Antisense; AAAACCACGGACTTAGCGGCATGCC
>probe:Drosophila_2:1624690_at:262:671; Interrogation_Position=212; Antisense; TACGAGCTCATTTTCCCAGCAGGGA
>probe:Drosophila_2:1624690_at:287:83; Interrogation_Position=231; Antisense; CAGGGACCAACGTGCTTCGATAAGA
>probe:Drosophila_2:1624690_at:521:375; Interrogation_Position=257; Antisense; GAAGACGGGCTTCATCATCGGATTC
>probe:Drosophila_2:1624690_at:631:41; Interrogation_Position=273; Antisense; ATCGGATTCTGCGTGGGCATGGCCA
>probe:Drosophila_2:1624690_at:682:469; Interrogation_Position=317; Antisense; GTTCTCGGCGCTCAGATACGGACTA
>probe:Drosophila_2:1624690_at:9:673; Interrogation_Position=340; Antisense; TACGCGGGCGGGAGCTGATCAACAA
>probe:Drosophila_2:1624690_at:62:253; Interrogation_Position=362; Antisense; CAACGTGGGCAAGACCATGGTCCAG
>probe:Drosophila_2:1624690_at:245:381; Interrogation_Position=394; Antisense; GAACCTTTGGCACCTTTATGGCCAT
>probe:Drosophila_2:1624690_at:666:47; Interrogation_Position=440; Antisense; ATCCTGCTGGCATTTGACTAGAGTT
>probe:Drosophila_2:1624690_at:177:657; Interrogation_Position=483; Antisense; TAAGCCCTACTCCAATCTTGTTTAA
>probe:Drosophila_2:1624690_at:40:175; Interrogation_Position=91; Antisense; AAACGAACCTTCTGCGAGATTCATA

Paste this into a BLAST search page for me
GCTCACACTCACACGTTTACGAATTGGAGCTTGCTACTCAGCGGTATCAAAAAACCACGGACTTAGCGGCATGCCTACGAGCTCATTTTCCCAGCAGGGACAGGGACCAACGTGCTTCGATAAGAGAAGACGGGCTTCATCATCGGATTCATCGGATTCTGCGTGGGCATGGCCAGTTCTCGGCGCTCAGATACGGACTATACGCGGGCGGGAGCTGATCAACAACAACGTGGGCAAGACCATGGTCCAGGAACCTTTGGCACCTTTATGGCCATATCCTGCTGGCATTTGACTAGAGTTTAAGCCCTACTCCAATCTTGTTTAAAAACGAACCTTCTGCGAGATTCATA

Full Affymetrix probeset data:

Annotations for 1624690_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720