FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624692_at:

>probe:Drosophila_2:1624692_at:655:427; Interrogation_Position=2197; Antisense; GAGATCTTGGATACGTATGTCGACA
>probe:Drosophila_2:1624692_at:136:439; Interrogation_Position=2317; Antisense; GATGGTCGCGTCAAGGAAACCCTCC
>probe:Drosophila_2:1624692_at:590:391; Interrogation_Position=2332; Antisense; GAAACCCTCCTGTTGGATCACCAAG
>probe:Drosophila_2:1624692_at:684:45; Interrogation_Position=2372; Antisense; ATCCTGCCCAGGATCTGTATTACTT
>probe:Drosophila_2:1624692_at:53:657; Interrogation_Position=2399; Antisense; TAATGAGCTCCACTCAACTGGACAT
>probe:Drosophila_2:1624692_at:31:455; Interrogation_Position=2431; Antisense; GATCAGTTTGACTACCTTATCCGAT
>probe:Drosophila_2:1624692_at:321:225; Interrogation_Position=2473; Antisense; AAGGAGCACGCCAAGCTGTTGAACT
>probe:Drosophila_2:1624692_at:129:169; Interrogation_Position=2520; Antisense; AAAGGAACTGCACGCCATTCTGATA
>probe:Drosophila_2:1624692_at:417:9; Interrogation_Position=2536; Antisense; ATTCTGATACAGCACCCCATTTTTG
>probe:Drosophila_2:1624692_at:665:597; Interrogation_Position=2562; Antisense; TGCTGGAACTGTGCTCACTACCTTG
>probe:Drosophila_2:1624692_at:325:147; Interrogation_Position=2578; Antisense; ACTACCTTGTCGATGTGTCTTAACA
>probe:Drosophila_2:1624692_at:584:397; Interrogation_Position=2604; Antisense; GACAACCGATGACTTTACCACTGAT
>probe:Drosophila_2:1624692_at:629:685; Interrogation_Position=2703; Antisense; TATAGAGCGTGTCATGCCATGGATA
>probe:Drosophila_2:1624692_at:410:653; Interrogation_Position=2748; Antisense; TAATTTTGCCAACGGACATTCCCAA

Paste this into a BLAST search page for me
GAGATCTTGGATACGTATGTCGACAGATGGTCGCGTCAAGGAAACCCTCCGAAACCCTCCTGTTGGATCACCAAGATCCTGCCCAGGATCTGTATTACTTTAATGAGCTCCACTCAACTGGACATGATCAGTTTGACTACCTTATCCGATAAGGAGCACGCCAAGCTGTTGAACTAAAGGAACTGCACGCCATTCTGATAATTCTGATACAGCACCCCATTTTTGTGCTGGAACTGTGCTCACTACCTTGACTACCTTGTCGATGTGTCTTAACAGACAACCGATGACTTTACCACTGATTATAGAGCGTGTCATGCCATGGATATAATTTTGCCAACGGACATTCCCAA

Full Affymetrix probeset data:

Annotations for 1624692_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720