FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624693_at:

>probe:Drosophila_2:1624693_at:357:697; Interrogation_Position=228; Antisense; TTGTAACCACCATACCAACCATAGG
>probe:Drosophila_2:1624693_at:726:199; Interrogation_Position=244; Antisense; AACCATAGGCTTCAATGTCGAGACT
>probe:Drosophila_2:1624693_at:285:303; Interrogation_Position=329; Antisense; CCGTTGTGGCGACACTATTTCCAAA
>probe:Drosophila_2:1624693_at:570:485; Interrogation_Position=374; Antisense; GTAGTGGATTCCAACGACCGCGATC
>probe:Drosophila_2:1624693_at:575:409; Interrogation_Position=389; Antisense; GACCGCGATCGTATAACTGAAGCTG
>probe:Drosophila_2:1624693_at:349:385; Interrogation_Position=419; Antisense; GAACTACAGAACATGCTCCAGGAGG
>probe:Drosophila_2:1624693_at:422:443; Interrogation_Position=443; Antisense; GATGAACTTAGGGACGCGGTACTTT
>probe:Drosophila_2:1624693_at:671:701; Interrogation_Position=472; Antisense; TTTTGCCAACAAACAGGACCTACCG
>probe:Drosophila_2:1624693_at:144:369; Interrogation_Position=496; Antisense; GAATGCAATGACAGCTGCCGAGCTT
>probe:Drosophila_2:1624693_at:694:417; Interrogation_Position=515; Antisense; GAGCTTACGGACAAGTTGCGCCTTA
>probe:Drosophila_2:1624693_at:580:367; Interrogation_Position=550; Antisense; GAATCGCCACTGGTTTATTCAGTCT
>probe:Drosophila_2:1624693_at:294:13; Interrogation_Position=566; Antisense; ATTCAGTCTACATGTGCTACCCAAG
>probe:Drosophila_2:1624693_at:399:671; Interrogation_Position=583; Antisense; TACCCAAGGGCACGGTCTTTATGAA
>probe:Drosophila_2:1624693_at:483:565; Interrogation_Position=671; Antisense; GGAATTGCTGTTCTCGTATGCTGAA

Paste this into a BLAST search page for me
TTGTAACCACCATACCAACCATAGGAACCATAGGCTTCAATGTCGAGACTCCGTTGTGGCGACACTATTTCCAAAGTAGTGGATTCCAACGACCGCGATCGACCGCGATCGTATAACTGAAGCTGGAACTACAGAACATGCTCCAGGAGGGATGAACTTAGGGACGCGGTACTTTTTTTGCCAACAAACAGGACCTACCGGAATGCAATGACAGCTGCCGAGCTTGAGCTTACGGACAAGTTGCGCCTTAGAATCGCCACTGGTTTATTCAGTCTATTCAGTCTACATGTGCTACCCAAGTACCCAAGGGCACGGTCTTTATGAAGGAATTGCTGTTCTCGTATGCTGAA

Full Affymetrix probeset data:

Annotations for 1624693_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720