FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624694_at:

>probe:Drosophila_2:1624694_at:456:323; Interrogation_Position=1090; Antisense; GCGCAAGCAGGTTACATGGGCATTT
>probe:Drosophila_2:1624694_at:468:269; Interrogation_Position=1104; Antisense; CATGGGCATTTAATCAGGCTGACTA
>probe:Drosophila_2:1624694_at:44:573; Interrogation_Position=1131; Antisense; GGCGAAGGTACTCCCAGAATCCGGA
>probe:Drosophila_2:1624694_at:110:111; Interrogation_Position=1146; Antisense; AGAATCCGGACTACGACCACGATCG
>probe:Drosophila_2:1624694_at:194:417; Interrogation_Position=1202; Antisense; GAGCGCTTGGACTCCGATAACTTTG
>probe:Drosophila_2:1624694_at:16:693; Interrogation_Position=1232; Antisense; TTTGATGGATTCGTGAGCTCTGTAC
>probe:Drosophila_2:1624694_at:93:199; Interrogation_Position=1271; Antisense; AACGCATTGCGTTGCTTTCCGGAAG
>probe:Drosophila_2:1624694_at:343:153; Interrogation_Position=1359; Antisense; ACAGGGAGTTAATTGCCACGGCCAA
>probe:Drosophila_2:1624694_at:202:695; Interrogation_Position=1424; Antisense; TTTCGTGACTCACAAAACCTGCTCA
>probe:Drosophila_2:1624694_at:454:141; Interrogation_Position=1511; Antisense; ACGGAGTCCCTGTTTGTGCAAGAAC
>probe:Drosophila_2:1624694_at:287:327; Interrogation_Position=1537; Antisense; GCGAGTGTACAAAATGGAGCCCCAG
>probe:Drosophila_2:1624694_at:118:553; Interrogation_Position=1552; Antisense; GGAGCCCCAGGATGTACAAGAATTT
>probe:Drosophila_2:1624694_at:725:363; Interrogation_Position=1571; Antisense; GAATTTTCACCTGGTACGGAGCCGC
>probe:Drosophila_2:1624694_at:59:553; Interrogation_Position=1588; Antisense; GGAGCCGCTGGATGACCAAACTTAT

Paste this into a BLAST search page for me
GCGCAAGCAGGTTACATGGGCATTTCATGGGCATTTAATCAGGCTGACTAGGCGAAGGTACTCCCAGAATCCGGAAGAATCCGGACTACGACCACGATCGGAGCGCTTGGACTCCGATAACTTTGTTTGATGGATTCGTGAGCTCTGTACAACGCATTGCGTTGCTTTCCGGAAGACAGGGAGTTAATTGCCACGGCCAATTTCGTGACTCACAAAACCTGCTCAACGGAGTCCCTGTTTGTGCAAGAACGCGAGTGTACAAAATGGAGCCCCAGGGAGCCCCAGGATGTACAAGAATTTGAATTTTCACCTGGTACGGAGCCGCGGAGCCGCTGGATGACCAAACTTAT

Full Affymetrix probeset data:

Annotations for 1624694_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720