Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624695_at:

>probe:Drosophila_2:1624695_at:366:595; Interrogation_Position=2642; Antisense; TGTGGCCAAGCGACTCATGGATTAC
>probe:Drosophila_2:1624695_at:617:65; Interrogation_Position=2658; Antisense; ATGGATTACGGCTTCCATGCACCAA
>probe:Drosophila_2:1624695_at:450:53; Interrogation_Position=2674; Antisense; ATGCACCAACTATGTCTTGGCCCGT
>probe:Drosophila_2:1624695_at:269:501; Interrogation_Position=2697; Antisense; GTCGCTGGAACCCTGATGATCGAGC
>probe:Drosophila_2:1624695_at:345:451; Interrogation_Position=2714; Antisense; GATCGAGCCCACTGAATCGGAGGAT
>probe:Drosophila_2:1624695_at:466:513; Interrogation_Position=2761; Antisense; GTGATGCCATGATTTCCATTCGAGA
>probe:Drosophila_2:1624695_at:350:235; Interrogation_Position=2829; Antisense; AATCCACTGAAGATGTCTCCTCACA
>probe:Drosophila_2:1624695_at:164:301; Interrogation_Position=2854; Antisense; CCCAAGCTCAGGTGATCTCGGATAA
>probe:Drosophila_2:1624695_at:213:23; Interrogation_Position=2891; Antisense; ATATACACGGGAGCAGGCTGCCTTC
>probe:Drosophila_2:1624695_at:315:633; Interrogation_Position=2914; Antisense; TCCCCGCCATCTTTGTAAAACCAGA
>probe:Drosophila_2:1624695_at:12:99; Interrogation_Position=2936; Antisense; AGATGCCAAGATCTGGCCCACTGTG
>probe:Drosophila_2:1624695_at:417:397; Interrogation_Position=2985; Antisense; GACAAGCACCTTGTGTGTACCTGTC
>probe:Drosophila_2:1624695_at:510:503; Interrogation_Position=3007; Antisense; GTCCGCCAATACTGCCTGATTTATA
>probe:Drosophila_2:1624695_at:444:657; Interrogation_Position=3030; Antisense; TAAGGCACTTCAGTTCTAAGACCAA

Paste this into a BLAST search page for me
TGTGGCCAAGCGACTCATGGATTACATGGATTACGGCTTCCATGCACCAAATGCACCAACTATGTCTTGGCCCGTGTCGCTGGAACCCTGATGATCGAGCGATCGAGCCCACTGAATCGGAGGATGTGATGCCATGATTTCCATTCGAGAAATCCACTGAAGATGTCTCCTCACACCCAAGCTCAGGTGATCTCGGATAAATATACACGGGAGCAGGCTGCCTTCTCCCCGCCATCTTTGTAAAACCAGAAGATGCCAAGATCTGGCCCACTGTGGACAAGCACCTTGTGTGTACCTGTCGTCCGCCAATACTGCCTGATTTATATAAGGCACTTCAGTTCTAAGACCAA

Full Affymetrix probeset data:

Annotations for 1624695_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime