FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624697_at:

>probe:Drosophila_2:1624697_at:45:385; Interrogation_Position=112; Antisense; GAACAGCGACTAGCCCAACTGGAAT
>probe:Drosophila_2:1624697_at:61:197; Interrogation_Position=128; Antisense; AACTGGAATCGGTCACATCACGGAT
>probe:Drosophila_2:1624697_at:573:345; Interrogation_Position=153; Antisense; GCATCTATACCATTCAAGGCGCGGG
>probe:Drosophila_2:1624697_at:663:57; Interrogation_Position=215; Antisense; ATGAGTACTTCACTCTGCTGGTGAG
>probe:Drosophila_2:1624697_at:79:623; Interrogation_Position=230; Antisense; TGCTGGTGAGGCACATTGCCCAGAC
>probe:Drosophila_2:1624697_at:573:625; Interrogation_Position=246; Antisense; TGCCCAGACGCACAGCTATTTGAAA
>probe:Drosophila_2:1624697_at:123:225; Interrogation_Position=280; Antisense; AAGGCACTGGACTTCCTGTACAAAG
>probe:Drosophila_2:1624697_at:679:489; Interrogation_Position=297; Antisense; GTACAAAGTCAACATCTGCTCCATC
>probe:Drosophila_2:1624697_at:132:39; Interrogation_Position=310; Antisense; ATCTGCTCCATCTGCGATTTGAAAT
>probe:Drosophila_2:1624697_at:12:231; Interrogation_Position=332; Antisense; AATGTGAGCCGCATGGCAGGCATTC
>probe:Drosophila_2:1624697_at:290:619; Interrogation_Position=397; Antisense; TGCATCAACAACGTCCTGCGGGAGA
>probe:Drosophila_2:1624697_at:671:375; Interrogation_Position=446; Antisense; GAAGAGCCCGTCATCACGAAGTCCG
>probe:Drosophila_2:1624697_at:344:373; Interrogation_Position=463; Antisense; GAAGTCCGCAGGATCTACGGCTTAA
>probe:Drosophila_2:1624697_at:294:551; Interrogation_Position=93; Antisense; GGAGAGCTTCGCCAGTCCAGAACAG

Paste this into a BLAST search page for me
GAACAGCGACTAGCCCAACTGGAATAACTGGAATCGGTCACATCACGGATGCATCTATACCATTCAAGGCGCGGGATGAGTACTTCACTCTGCTGGTGAGTGCTGGTGAGGCACATTGCCCAGACTGCCCAGACGCACAGCTATTTGAAAAAGGCACTGGACTTCCTGTACAAAGGTACAAAGTCAACATCTGCTCCATCATCTGCTCCATCTGCGATTTGAAATAATGTGAGCCGCATGGCAGGCATTCTGCATCAACAACGTCCTGCGGGAGAGAAGAGCCCGTCATCACGAAGTCCGGAAGTCCGCAGGATCTACGGCTTAAGGAGAGCTTCGCCAGTCCAGAACAG

Full Affymetrix probeset data:

Annotations for 1624697_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720