FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624701_at:

>probe:Drosophila_2:1624701_at:104:171; Interrogation_Position=250; Antisense; AAAGTCTTGGCCTCTAAGTATCCTC
>probe:Drosophila_2:1624701_at:367:217; Interrogation_Position=265; Antisense; AAGTATCCTCTATATCCAACGACAC
>probe:Drosophila_2:1624701_at:312:393; Interrogation_Position=290; Antisense; GAAAGCAGTCTTTCATTACCGAGGA
>probe:Drosophila_2:1624701_at:493:405; Interrogation_Position=319; Antisense; GACTCCCAGCACAGTGGCATGGAAA
>probe:Drosophila_2:1624701_at:9:155; Interrogation_Position=400; Antisense; ACAGTCAGTCAGTTCGAGGGCGTTT
>probe:Drosophila_2:1624701_at:130:195; Interrogation_Position=485; Antisense; AACTGAAGGCCGTCGATGTTTCTGT
>probe:Drosophila_2:1624701_at:607:641; Interrogation_Position=505; Antisense; TCTGTGGCCCAGACTACTAACGAAT
>probe:Drosophila_2:1624701_at:521:199; Interrogation_Position=523; Antisense; AACGAATCCAGCGTCTGTGTGGCTC
>probe:Drosophila_2:1624701_at:48:37; Interrogation_Position=591; Antisense; ATCTTCTGCGGCTGCTTTAGACCAA
>probe:Drosophila_2:1624701_at:395:699; Interrogation_Position=606; Antisense; TTTAGACCAATCTCCAAGCGACGAG
>probe:Drosophila_2:1624701_at:24:721; Interrogation_Position=637; Antisense; TTCCTCCGCTATCTGGGCAGCAAAT
>probe:Drosophila_2:1624701_at:274:705; Interrogation_Position=661; Antisense; TTAGGCAAATACTCTGCCCGCACAA
>probe:Drosophila_2:1624701_at:571:83; Interrogation_Position=693; Antisense; AGTCCAGTTTCACATTAATCGCATA
>probe:Drosophila_2:1624701_at:45:491; Interrogation_Position=720; Antisense; GTACAAGGCGGACATGGGTCACTTT

Paste this into a BLAST search page for me
AAAGTCTTGGCCTCTAAGTATCCTCAAGTATCCTCTATATCCAACGACACGAAAGCAGTCTTTCATTACCGAGGAGACTCCCAGCACAGTGGCATGGAAAACAGTCAGTCAGTTCGAGGGCGTTTAACTGAAGGCCGTCGATGTTTCTGTTCTGTGGCCCAGACTACTAACGAATAACGAATCCAGCGTCTGTGTGGCTCATCTTCTGCGGCTGCTTTAGACCAATTTAGACCAATCTCCAAGCGACGAGTTCCTCCGCTATCTGGGCAGCAAATTTAGGCAAATACTCTGCCCGCACAAAGTCCAGTTTCACATTAATCGCATAGTACAAGGCGGACATGGGTCACTTT

Full Affymetrix probeset data:

Annotations for 1624701_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720