Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624704_at:

>probe:Drosophila_2:1624704_at:448:59; Interrogation_Position=256; Antisense; ATGTTATTTTATCCCAGCTATGTCA
>probe:Drosophila_2:1624704_at:505:15; Interrogation_Position=280; Antisense; ATTTACATTGTGCTGGTCTTCCTCT
>probe:Drosophila_2:1624704_at:691:693; Interrogation_Position=316; Antisense; TTTCCTCTGGCCATGATTATGAGCG
>probe:Drosophila_2:1624704_at:48:231; Interrogation_Position=361; Antisense; AATGTGCGGAATCTGGCCCAGCAGA
>probe:Drosophila_2:1624704_at:20:417; Interrogation_Position=392; Antisense; GAGCCCGTCGCCAAATGGAGATCAA
>probe:Drosophila_2:1624704_at:488:391; Interrogation_Position=455; Antisense; GAAACGTGTGCTCAAACAGCCAGAA
>probe:Drosophila_2:1624704_at:355:381; Interrogation_Position=477; Antisense; GAACGAAGTTAGTGTCCTGCCCAAG
>probe:Drosophila_2:1624704_at:434:213; Interrogation_Position=499; Antisense; AAGACCTTGGATTTGCCGCCCAGCT
>probe:Drosophila_2:1624704_at:31:409; Interrogation_Position=526; Antisense; GACGAGGCCGCTTTTAGCGAGCGAA
>probe:Drosophila_2:1624704_at:545:27; Interrogation_Position=571; Antisense; ATAGCCACCAGCTTGGAAGCGAGCA
>probe:Drosophila_2:1624704_at:421:377; Interrogation_Position=586; Antisense; GAAGCGAGCAATCCCAATTTGGCGG
>probe:Drosophila_2:1624704_at:54:479; Interrogation_Position=634; Antisense; GTTTACGAGGCGAACGTGGCCACAA
>probe:Drosophila_2:1624704_at:126:399; Interrogation_Position=774; Antisense; GACACTGTACAGCTTTGCCTTTGTA
>probe:Drosophila_2:1624704_at:188:165; Interrogation_Position=798; Antisense; AAATAAATCTTGCTCCTCGGCAACT

Paste this into a BLAST search page for me
ATGTTATTTTATCCCAGCTATGTCAATTTACATTGTGCTGGTCTTCCTCTTTTCCTCTGGCCATGATTATGAGCGAATGTGCGGAATCTGGCCCAGCAGAGAGCCCGTCGCCAAATGGAGATCAAGAAACGTGTGCTCAAACAGCCAGAAGAACGAAGTTAGTGTCCTGCCCAAGAAGACCTTGGATTTGCCGCCCAGCTGACGAGGCCGCTTTTAGCGAGCGAAATAGCCACCAGCTTGGAAGCGAGCAGAAGCGAGCAATCCCAATTTGGCGGGTTTACGAGGCGAACGTGGCCACAAGACACTGTACAGCTTTGCCTTTGTAAAATAAATCTTGCTCCTCGGCAACT

Full Affymetrix probeset data:

Annotations for 1624704_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime