FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624708_at:

>probe:Drosophila_2:1624708_at:577:39; Interrogation_Position=1043; Antisense; ATCGAAACTTCGACTACGGCTGGGA
>probe:Drosophila_2:1624708_at:365:451; Interrogation_Position=1076; Antisense; GATCGACGAGCAATCCCTGCAAGAA
>probe:Drosophila_2:1624708_at:72:211; Interrogation_Position=1096; Antisense; AAGAATCTCTATCGCGGAGCCCATA
>probe:Drosophila_2:1624708_at:325:233; Interrogation_Position=1167; Antisense; AATGCGCGAGTATCTGGGTGCCTAT
>probe:Drosophila_2:1624708_at:42:341; Interrogation_Position=1282; Antisense; GCTAGAAGGGCAGTTCTCGCACTGA
>probe:Drosophila_2:1624708_at:450:235; Interrogation_Position=1315; Antisense; AATCAGGCGGAGTATTCGTCGGGCA
>probe:Drosophila_2:1624708_at:193:501; Interrogation_Position=1332; Antisense; GTCGGGCACCAGTTATCGCCAAAAG
>probe:Drosophila_2:1624708_at:559:193; Interrogation_Position=1372; Antisense; AACTCGGCCGATTGGGTGCAGGATC
>probe:Drosophila_2:1624708_at:553:349; Interrogation_Position=1389; Antisense; GCAGGATCGCATTGGACCGCAGCTG
>probe:Drosophila_2:1624708_at:139:133; Interrogation_Position=1404; Antisense; ACCGCAGCTGGTGTTCAATATGTTC
>probe:Drosophila_2:1624708_at:343:251; Interrogation_Position=1431; Antisense; CAAGGATCAGGGACGCTATGGCTAC
>probe:Drosophila_2:1624708_at:413:435; Interrogation_Position=1489; Antisense; GAGGAGGTCTTCGAGTTCCTGCGCA
>probe:Drosophila_2:1624708_at:492:103; Interrogation_Position=974; Antisense; AGACGGATCGCCTGTGGACCAAAAA
>probe:Drosophila_2:1624708_at:311:173; Interrogation_Position=996; Antisense; AAACCGTGGCTACGACAGTGTCAGT

Paste this into a BLAST search page for me
ATCGAAACTTCGACTACGGCTGGGAGATCGACGAGCAATCCCTGCAAGAAAAGAATCTCTATCGCGGAGCCCATAAATGCGCGAGTATCTGGGTGCCTATGCTAGAAGGGCAGTTCTCGCACTGAAATCAGGCGGAGTATTCGTCGGGCAGTCGGGCACCAGTTATCGCCAAAAGAACTCGGCCGATTGGGTGCAGGATCGCAGGATCGCATTGGACCGCAGCTGACCGCAGCTGGTGTTCAATATGTTCCAAGGATCAGGGACGCTATGGCTACGAGGAGGTCTTCGAGTTCCTGCGCAAGACGGATCGCCTGTGGACCAAAAAAAACCGTGGCTACGACAGTGTCAGT

Full Affymetrix probeset data:

Annotations for 1624708_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720