Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624710_at:

>probe:Drosophila_2:1624710_at:185:621; Interrogation_Position=105; Antisense; TGCTGCAGAGAAGCACTTGCTGCAA
>probe:Drosophila_2:1624710_at:521:149; Interrogation_Position=119; Antisense; ACTTGCTGCAAGTGCCCCACTTTAT
>probe:Drosophila_2:1624710_at:74:627; Interrogation_Position=131; Antisense; TGCCCCACTTTATTTTGTTAAGCGC
>probe:Drosophila_2:1624710_at:548:687; Interrogation_Position=144; Antisense; TTTGTTAAGCGCCTTCGATGGCCAA
>probe:Drosophila_2:1624710_at:345:123; Interrogation_Position=151; Antisense; AGCGCCTTCGATGGCCAACAAACGA
>probe:Drosophila_2:1624710_at:198:297; Interrogation_Position=173; Antisense; CGAAAAGTCCTTTGAGCCATGAAAT
>probe:Drosophila_2:1624710_at:238:415; Interrogation_Position=186; Antisense; GAGCCATGAAATTCAAAACCTACAG
>probe:Drosophila_2:1624710_at:584:255; Interrogation_Position=199; Antisense; CAAAACCTACAGACGTACACGCAGT
>probe:Drosophila_2:1624710_at:124:663; Interrogation_Position=214; Antisense; TACACGCAGTACAAGGTGACAGTGC
>probe:Drosophila_2:1624710_at:535:511; Interrogation_Position=229; Antisense; GTGACAGTGCAGGTGTTCAATCCCG
>probe:Drosophila_2:1624710_at:109:509; Interrogation_Position=235; Antisense; GTGCAGGTGTTCAATCCCGAGGGTC
>probe:Drosophila_2:1624710_at:620:611; Interrogation_Position=245; Antisense; TCAATCCCGAGGGTCTGGGACCGGA
>probe:Drosophila_2:1624710_at:633:593; Interrogation_Position=260; Antisense; TGGGACCGGAGACCACCATCCTGGT
>probe:Drosophila_2:1624710_at:520:425; Interrogation_Position=268; Antisense; GAGACCACCATCCTGGTGATGACCG

Paste this into a BLAST search page for me
TGCTGCAGAGAAGCACTTGCTGCAAACTTGCTGCAAGTGCCCCACTTTATTGCCCCACTTTATTTTGTTAAGCGCTTTGTTAAGCGCCTTCGATGGCCAAAGCGCCTTCGATGGCCAACAAACGACGAAAAGTCCTTTGAGCCATGAAATGAGCCATGAAATTCAAAACCTACAGCAAAACCTACAGACGTACACGCAGTTACACGCAGTACAAGGTGACAGTGCGTGACAGTGCAGGTGTTCAATCCCGGTGCAGGTGTTCAATCCCGAGGGTCTCAATCCCGAGGGTCTGGGACCGGATGGGACCGGAGACCACCATCCTGGTGAGACCACCATCCTGGTGATGACCG

Full Affymetrix probeset data:

Annotations for 1624710_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime