FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624711_at:

>probe:Drosophila_2:1624711_at:691:191; Interrogation_Position=145; Antisense; AACTTCAACGTATTTCTTCAGCAGG
>probe:Drosophila_2:1624711_at:485:125; Interrogation_Position=196; Antisense; AGCCCCTCCTGCAGATTTTAGAAGA
>probe:Drosophila_2:1624711_at:97:77; Interrogation_Position=218; Antisense; AGAGATTCCAGTGTCCTTTACCAAA
>probe:Drosophila_2:1624711_at:141:215; Interrogation_Position=254; Antisense; AAGATGGTTCTGATGCTTTGCTGCA
>probe:Drosophila_2:1624711_at:118:283; Interrogation_Position=316; Antisense; CTGCCTGGCTCCTTTGATGGGAGGA
>probe:Drosophila_2:1624711_at:542:561; Interrogation_Position=338; Antisense; GGAACTCCCTATTGCGGATGTGGTC
>probe:Drosophila_2:1624711_at:373:503; Interrogation_Position=360; Antisense; GTCCCTGTGGAGGTTGCTGTAGTCC
>probe:Drosophila_2:1624711_at:269:601; Interrogation_Position=377; Antisense; TGTAGTCCTTGCTGTGGTCCATGTG
>probe:Drosophila_2:1624711_at:171:119; Interrogation_Position=419; Antisense; AGCTCGTGTCCTTGCGGCTGGTGAA
>probe:Drosophila_2:1624711_at:406:205; Interrogation_Position=442; Antisense; AAGCGCCCGCTATCATAGGCATTAA
>probe:Drosophila_2:1624711_at:583:567; Interrogation_Position=470; Antisense; GGCAGCAAGCGGTAACAAGTCAATT
>probe:Drosophila_2:1624711_at:583:23; Interrogation_Position=530; Antisense; ATATGTTGCTGTTCGAATTCCTTTT
>probe:Drosophila_2:1624711_at:348:557; Interrogation_Position=56; Antisense; GGACTGAACACATCTCTTTCGTAAA
>probe:Drosophila_2:1624711_at:686:523; Interrogation_Position=566; Antisense; GGGCTAAACCAACTAAGCTCTCGTA

Paste this into a BLAST search page for me
AACTTCAACGTATTTCTTCAGCAGGAGCCCCTCCTGCAGATTTTAGAAGAAGAGATTCCAGTGTCCTTTACCAAAAAGATGGTTCTGATGCTTTGCTGCACTGCCTGGCTCCTTTGATGGGAGGAGGAACTCCCTATTGCGGATGTGGTCGTCCCTGTGGAGGTTGCTGTAGTCCTGTAGTCCTTGCTGTGGTCCATGTGAGCTCGTGTCCTTGCGGCTGGTGAAAAGCGCCCGCTATCATAGGCATTAAGGCAGCAAGCGGTAACAAGTCAATTATATGTTGCTGTTCGAATTCCTTTTGGACTGAACACATCTCTTTCGTAAAGGGCTAAACCAACTAAGCTCTCGTA

Full Affymetrix probeset data:

Annotations for 1624711_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720