FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624713_at:

>probe:Drosophila_2:1624713_at:625:57; Interrogation_Position=103; Antisense; ATGATGTCTCCATGTCGGAATCCGC
>probe:Drosophila_2:1624713_at:404:161; Interrogation_Position=128; Antisense; ACAATGGAGTGACCGCCTGGCGCTT
>probe:Drosophila_2:1624713_at:551:123; Interrogation_Position=163; Antisense; AGCGAACCCGCTTTATCATCAAAGG
>probe:Drosophila_2:1624713_at:147:255; Interrogation_Position=182; Antisense; CAAAGGGAAATCAAGCTGTCAGTCA
>probe:Drosophila_2:1624713_at:641:249; Interrogation_Position=21; Antisense; GCATAGGGAACCTCGCCCAAATCGA
>probe:Drosophila_2:1624713_at:192:531; Interrogation_Position=265; Antisense; GGGTCAGGACCCCTATCCGAGATTC
>probe:Drosophila_2:1624713_at:307:633; Interrogation_Position=280; Antisense; TCCGAGATTCTCACTGCCGTTGGTT
>probe:Drosophila_2:1624713_at:555:465; Interrogation_Position=298; Antisense; GTTGGTTCCGAGGTGGCGCTCCCAT
>probe:Drosophila_2:1624713_at:530:39; Interrogation_Position=326; Antisense; ATCTGGTGCCCGGAACTGGGATCGT
>probe:Drosophila_2:1624713_at:53:287; Interrogation_Position=341; Antisense; CTGGGATCGTCGACAAGGTGCAGCT
>probe:Drosophila_2:1624713_at:359:223; Interrogation_Position=355; Antisense; AAGGTGCAGCTGGTCATCTGGTATC
>probe:Drosophila_2:1624713_at:572:537; Interrogation_Position=366; Antisense; GGTCATCTGGTATCGCCAGGGAAAC
>probe:Drosophila_2:1624713_at:473:525; Interrogation_Position=384; Antisense; GGGAAACGTGAAGCCCATCTATACG
>probe:Drosophila_2:1624713_at:402:237; Interrogation_Position=40; Antisense; AATCGACCTGGTCTGTGCGGAACTG

Paste this into a BLAST search page for me
ATGATGTCTCCATGTCGGAATCCGCACAATGGAGTGACCGCCTGGCGCTTAGCGAACCCGCTTTATCATCAAAGGCAAAGGGAAATCAAGCTGTCAGTCAGCATAGGGAACCTCGCCCAAATCGAGGGTCAGGACCCCTATCCGAGATTCTCCGAGATTCTCACTGCCGTTGGTTGTTGGTTCCGAGGTGGCGCTCCCATATCTGGTGCCCGGAACTGGGATCGTCTGGGATCGTCGACAAGGTGCAGCTAAGGTGCAGCTGGTCATCTGGTATCGGTCATCTGGTATCGCCAGGGAAACGGGAAACGTGAAGCCCATCTATACGAATCGACCTGGTCTGTGCGGAACTG

Full Affymetrix probeset data:

Annotations for 1624713_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720