Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624714_at:

>probe:Drosophila_2:1624714_at:430:601; Interrogation_Position=5571; Antisense; TGTACGCATATTTCGATTGTCTCTA
>probe:Drosophila_2:1624714_at:626:465; Interrogation_Position=5585; Antisense; GATTGTCTCTAGTTGCGATAACGCT
>probe:Drosophila_2:1624714_at:700:31; Interrogation_Position=5602; Antisense; ATAACGCTGATGGAGGTGACCTTGT
>probe:Drosophila_2:1624714_at:334:253; Interrogation_Position=5646; Antisense; CAAGCACATCTCACTTTCGATTGAC
>probe:Drosophila_2:1624714_at:623:165; Interrogation_Position=5716; Antisense; AACTAAACTTAACACCCACTCACAT
>probe:Drosophila_2:1624714_at:559:135; Interrogation_Position=5745; Antisense; ACGCACACTCATGTAGACACGCGAG
>probe:Drosophila_2:1624714_at:127:399; Interrogation_Position=5760; Antisense; GACACGCGAGACATTTTCATTAGTT
>probe:Drosophila_2:1624714_at:466:491; Interrogation_Position=5793; Antisense; GTAAGATCGTAAGCCAGACAACCAG
>probe:Drosophila_2:1624714_at:172:203; Interrogation_Position=5812; Antisense; AACCAGGCATCTTTAGTCATTACTT
>probe:Drosophila_2:1624714_at:502:441; Interrogation_Position=5941; Antisense; GATGGATGACCAGATTCCCGTGTAC
>probe:Drosophila_2:1624714_at:225:9; Interrogation_Position=5954; Antisense; ATTCCCGTGTACAATGTGGGCTGTA
>probe:Drosophila_2:1624714_at:166:517; Interrogation_Position=5969; Antisense; GTGGGCTGTACATAGGATGCGAACC
>probe:Drosophila_2:1624714_at:585:545; Interrogation_Position=5983; Antisense; GGATGCGAACCTTAACAATTAGCCG
>probe:Drosophila_2:1624714_at:395:675; Interrogation_Position=6002; Antisense; TAGCCGCGCTGTTGTTGTAAGTGTT

Paste this into a BLAST search page for me
TGTACGCATATTTCGATTGTCTCTAGATTGTCTCTAGTTGCGATAACGCTATAACGCTGATGGAGGTGACCTTGTCAAGCACATCTCACTTTCGATTGACAACTAAACTTAACACCCACTCACATACGCACACTCATGTAGACACGCGAGGACACGCGAGACATTTTCATTAGTTGTAAGATCGTAAGCCAGACAACCAGAACCAGGCATCTTTAGTCATTACTTGATGGATGACCAGATTCCCGTGTACATTCCCGTGTACAATGTGGGCTGTAGTGGGCTGTACATAGGATGCGAACCGGATGCGAACCTTAACAATTAGCCGTAGCCGCGCTGTTGTTGTAAGTGTT

Full Affymetrix probeset data:

Annotations for 1624714_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime