FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624715_at:

>probe:Drosophila_2:1624715_at:342:311; Interrogation_Position=410; Antisense; GCCAAAAGTTCGGTGTGCGCAGCTA
>probe:Drosophila_2:1624715_at:668:181; Interrogation_Position=413; Antisense; AAAAGTTCGGTGTGCGCAGCTACTC
>probe:Drosophila_2:1624715_at:203:517; Interrogation_Position=422; Antisense; GTGTGCGCAGCTACTCGGCCAAGAG
>probe:Drosophila_2:1624715_at:37:669; Interrogation_Position=433; Antisense; TACTCGGCCAAGAGCACCATCGAGG
>probe:Drosophila_2:1624715_at:609:637; Interrogation_Position=452; Antisense; TCGAGGACATCAAGTTCCGCGTGCT
>probe:Drosophila_2:1624715_at:564:557; Interrogation_Position=456; Antisense; GGACATCAAGTTCCGCGTGCTAAAG
>probe:Drosophila_2:1624715_at:247:31; Interrogation_Position=460; Antisense; ATCAAGTTCCGCGTGCTAAAGGTTG
>probe:Drosophila_2:1624715_at:726:91; Interrogation_Position=464; Antisense; AGTTCCGCGTGCTAAAGGTTGTCTC
>probe:Drosophila_2:1624715_at:237:329; Interrogation_Position=470; Antisense; GCGTGCTAAAGGTTGTCTCCGCCTA
>probe:Drosophila_2:1624715_at:486:663; Interrogation_Position=476; Antisense; TAAAGGTTGTCTCCGCCTACGACAA
>probe:Drosophila_2:1624715_at:321:467; Interrogation_Position=481; Antisense; GTTGTCTCCGCCTACGACAAAGTGA
>probe:Drosophila_2:1624715_at:377:315; Interrogation_Position=490; Antisense; GCCTACGACAAAGTGACCGCCGAAA
>probe:Drosophila_2:1624715_at:272:83; Interrogation_Position=501; Antisense; AGTGACCGCCGAAAAGCTCAACGTT
>probe:Drosophila_2:1624715_at:361:323; Interrogation_Position=504; Antisense; GACCGCCGAAAAGCTCAACGTTGAG

Paste this into a BLAST search page for me
GCCAAAAGTTCGGTGTGCGCAGCTAAAAAGTTCGGTGTGCGCAGCTACTCGTGTGCGCAGCTACTCGGCCAAGAGTACTCGGCCAAGAGCACCATCGAGGTCGAGGACATCAAGTTCCGCGTGCTGGACATCAAGTTCCGCGTGCTAAAGATCAAGTTCCGCGTGCTAAAGGTTGAGTTCCGCGTGCTAAAGGTTGTCTCGCGTGCTAAAGGTTGTCTCCGCCTATAAAGGTTGTCTCCGCCTACGACAAGTTGTCTCCGCCTACGACAAAGTGAGCCTACGACAAAGTGACCGCCGAAAAGTGACCGCCGAAAAGCTCAACGTTGACCGCCGAAAAGCTCAACGTTGAG

Full Affymetrix probeset data:

Annotations for 1624715_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720