Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624717_s_at:

>probe:Drosophila_2:1624717_s_at:438:463; Interrogation_Position=1023; Antisense; GATTGCCATGTCCACCATAATGCTG
>probe:Drosophila_2:1624717_s_at:39:463; Interrogation_Position=1049; Antisense; GATTCCTGGGCAATAGCTTCCTGAA
>probe:Drosophila_2:1624717_s_at:398:47; Interrogation_Position=1137; Antisense; ATCCTCATTTTTTGTTGCTCCTAAA
>probe:Drosophila_2:1624717_s_at:564:39; Interrogation_Position=582; Antisense; ATCGTACTTGCAACGCCTTAAGGCG
>probe:Drosophila_2:1624717_s_at:222:231; Interrogation_Position=636; Antisense; AATGACGTCGTTGCTTTGGCTGCCA
>probe:Drosophila_2:1624717_s_at:716:403; Interrogation_Position=664; Antisense; GACTATCTCGCCCAGCTGATTTTGG
>probe:Drosophila_2:1624717_s_at:59:277; Interrogation_Position=717; Antisense; CTTTACAGCTGCACTCGAGGAGGAC
>probe:Drosophila_2:1624717_s_at:127:75; Interrogation_Position=737; Antisense; AGGACTGTGTTGACTTTCAGGGCAA
>probe:Drosophila_2:1624717_s_at:536:379; Interrogation_Position=768; Antisense; GAACCACGGAATGCTCTATGTGCCT
>probe:Drosophila_2:1624717_s_at:296:555; Interrogation_Position=793; Antisense; GGACCAGGAGTCTGTAGCCTTTGCG
>probe:Drosophila_2:1624717_s_at:406:509; Interrogation_Position=843; Antisense; GTGCAAGGCCATCTACTGTGATCCA
>probe:Drosophila_2:1624717_s_at:168:597; Interrogation_Position=859; Antisense; TGTGATCCACCCTATTTTTGCAAAA
>probe:Drosophila_2:1624717_s_at:129:513; Interrogation_Position=908; Antisense; GTGAGTTCGAGTGCTTGGATCCGCC
>probe:Drosophila_2:1624717_s_at:503:189; Interrogation_Position=991; Antisense; AACAGTACGGCCTCGAATGTGCAAC

Paste this into a BLAST search page for me
GATTGCCATGTCCACCATAATGCTGGATTCCTGGGCAATAGCTTCCTGAAATCCTCATTTTTTGTTGCTCCTAAAATCGTACTTGCAACGCCTTAAGGCGAATGACGTCGTTGCTTTGGCTGCCAGACTATCTCGCCCAGCTGATTTTGGCTTTACAGCTGCACTCGAGGAGGACAGGACTGTGTTGACTTTCAGGGCAAGAACCACGGAATGCTCTATGTGCCTGGACCAGGAGTCTGTAGCCTTTGCGGTGCAAGGCCATCTACTGTGATCCATGTGATCCACCCTATTTTTGCAAAAGTGAGTTCGAGTGCTTGGATCCGCCAACAGTACGGCCTCGAATGTGCAAC

Full Affymetrix probeset data:

Annotations for 1624717_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime