FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624719_at:

>probe:Drosophila_2:1624719_at:142:273; Interrogation_Position=5793; Antisense; CATTTCATATTGGTAGATTTCTCAT
>probe:Drosophila_2:1624719_at:194:165; Interrogation_Position=5827; Antisense; AAATCATTGGAGACGGGATTCGAAA
>probe:Drosophila_2:1624719_at:653:283; Interrogation_Position=5947; Antisense; CGTAATTATGATTTTGATGCAACCG
>probe:Drosophila_2:1624719_at:470:355; Interrogation_Position=5965; Antisense; GCAACCGAATTGTGATGATGTGATA
>probe:Drosophila_2:1624719_at:585:53; Interrogation_Position=6042; Antisense; ATGAAGTAATCGCAGTGCCCCCAAA
>probe:Drosophila_2:1624719_at:118:575; Interrogation_Position=6069; Antisense; GGCCAGGCCAAAAACACTGAAACTG
>probe:Drosophila_2:1624719_at:720:193; Interrogation_Position=6089; Antisense; AACTGAAGCAGAGGCAGCTGAAACT
>probe:Drosophila_2:1624719_at:99:391; Interrogation_Position=6108; Antisense; GAAACTGAAGCTGAATCTGAATCGA
>probe:Drosophila_2:1624719_at:712:59; Interrogation_Position=6173; Antisense; ATGTATTTGTATTATTGTCGTTGTC
>probe:Drosophila_2:1624719_at:451:637; Interrogation_Position=6190; Antisense; TCGTTGTCGTTGTCGCTCATAGACA
>probe:Drosophila_2:1624719_at:674:105; Interrogation_Position=6210; Antisense; AGACAATGTCTGATGGCTAAAATAT
>probe:Drosophila_2:1624719_at:344:611; Interrogation_Position=6248; Antisense; TGACTTGAGGCATACATTCTTTTTT
>probe:Drosophila_2:1624719_at:69:279; Interrogation_Position=6286; Antisense; CTATAGAACGCGATATTTGTATTGT
>probe:Drosophila_2:1624719_at:583:215; Interrogation_Position=6321; Antisense; AAGTTGTTGTGTACACACTGCGAAA

Paste this into a BLAST search page for me
CATTTCATATTGGTAGATTTCTCATAAATCATTGGAGACGGGATTCGAAACGTAATTATGATTTTGATGCAACCGGCAACCGAATTGTGATGATGTGATAATGAAGTAATCGCAGTGCCCCCAAAGGCCAGGCCAAAAACACTGAAACTGAACTGAAGCAGAGGCAGCTGAAACTGAAACTGAAGCTGAATCTGAATCGAATGTATTTGTATTATTGTCGTTGTCTCGTTGTCGTTGTCGCTCATAGACAAGACAATGTCTGATGGCTAAAATATTGACTTGAGGCATACATTCTTTTTTCTATAGAACGCGATATTTGTATTGTAAGTTGTTGTGTACACACTGCGAAA

Full Affymetrix probeset data:

Annotations for 1624719_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720