FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624721_at:

>probe:Drosophila_2:1624721_at:497:255; Interrogation_Position=2906; Antisense; CAACAAATCGTGGTGATATCGCTAA
>probe:Drosophila_2:1624721_at:8:489; Interrogation_Position=2959; Antisense; GTACTTATAATTTTCAATCGACCTC
>probe:Drosophila_2:1624721_at:406:41; Interrogation_Position=2975; Antisense; ATCGACCTCTTTTAAACCGTTGCTG
>probe:Drosophila_2:1624721_at:650:663; Interrogation_Position=2987; Antisense; TAAACCGTTGCTGGCACAAACCAAA
>probe:Drosophila_2:1624721_at:560:185; Interrogation_Position=3023; Antisense; AACAAAACATTTAGACGCACGACGT
>probe:Drosophila_2:1624721_at:67:409; Interrogation_Position=3036; Antisense; GACGCACGACGTAATTAAGGTATTT
>probe:Drosophila_2:1624721_at:721:539; Interrogation_Position=3054; Antisense; GGTATTTTAATTGGTGCACAGACAC
>probe:Drosophila_2:1624721_at:217:7; Interrogation_Position=3081; Antisense; ATTGCAAACGGCATCCCATATATTT
>probe:Drosophila_2:1624721_at:299:639; Interrogation_Position=3116; Antisense; TCGGCGAAGTTATCCAAAATGCATT
>probe:Drosophila_2:1624721_at:218:193; Interrogation_Position=3174; Antisense; AACTCAGTAACAATCAGCAATCCGA
>probe:Drosophila_2:1624721_at:443:549; Interrogation_Position=3253; Antisense; GGAGTGCTACAAATTTTACCAATTA
>probe:Drosophila_2:1624721_at:497:443; Interrogation_Position=3286; Antisense; GATGTACTAATGTTTGGTCACCAAA
>probe:Drosophila_2:1624721_at:254:685; Interrogation_Position=3356; Antisense; TATAAAGCGTTGAGACACCCACACA
>probe:Drosophila_2:1624721_at:395:105; Interrogation_Position=3368; Antisense; AGACACCCACACACATAAATGCGAA

Paste this into a BLAST search page for me
CAACAAATCGTGGTGATATCGCTAAGTACTTATAATTTTCAATCGACCTCATCGACCTCTTTTAAACCGTTGCTGTAAACCGTTGCTGGCACAAACCAAAAACAAAACATTTAGACGCACGACGTGACGCACGACGTAATTAAGGTATTTGGTATTTTAATTGGTGCACAGACACATTGCAAACGGCATCCCATATATTTTCGGCGAAGTTATCCAAAATGCATTAACTCAGTAACAATCAGCAATCCGAGGAGTGCTACAAATTTTACCAATTAGATGTACTAATGTTTGGTCACCAAATATAAAGCGTTGAGACACCCACACAAGACACCCACACACATAAATGCGAA

Full Affymetrix probeset data:

Annotations for 1624721_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720