FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624724_at:

>probe:Drosophila_2:1624724_at:475:115; Interrogation_Position=1580; Antisense; AGCTTGATTTACAACGGTCTCGCCG
>probe:Drosophila_2:1624724_at:349:437; Interrogation_Position=1658; Antisense; GAGGAGATCAGCACGCACGACCGAG
>probe:Drosophila_2:1624724_at:259:513; Interrogation_Position=1709; Antisense; GTGATGGCCATCTGTAGCAGCTGCC
>probe:Drosophila_2:1624724_at:197:157; Interrogation_Position=1734; Antisense; ACACGGAGCCTTTCCAGGGTGCCAT
>probe:Drosophila_2:1624724_at:404:81; Interrogation_Position=1749; Antisense; AGGGTGCCATCGTGTTTTCGTGGAA
>probe:Drosophila_2:1624724_at:37:653; Interrogation_Position=1803; Antisense; TCAAGGGCCTCAGTGTGGGTCCATG
>probe:Drosophila_2:1624724_at:546:531; Interrogation_Position=1819; Antisense; GGGTCCATGTGGTAACTTCTAGTTG
>probe:Drosophila_2:1624724_at:242:635; Interrogation_Position=1836; Antisense; TCTAGTTGTTCCCAAAGTTCGGATA
>probe:Drosophila_2:1624724_at:471:189; Interrogation_Position=1860; Antisense; AACATTCTAGTGTCCTAGGACCCCA
>probe:Drosophila_2:1624724_at:240:11; Interrogation_Position=1954; Antisense; ATTCGATTGGTTGGGCATCTTGTGC
>probe:Drosophila_2:1624724_at:459:37; Interrogation_Position=1970; Antisense; ATCTTGTGCCACAATTGTCCATGTG
>probe:Drosophila_2:1624724_at:252:505; Interrogation_Position=1986; Antisense; GTCCATGTGGGAGTCAACGCTTTAC
>probe:Drosophila_2:1624724_at:657:197; Interrogation_Position=2001; Antisense; AACGCTTTACTGTTGCCACCCATTT
>probe:Drosophila_2:1624724_at:670:179; Interrogation_Position=2033; Antisense; AAACAATCCTTGACTCGCTCATGGA

Paste this into a BLAST search page for me
AGCTTGATTTACAACGGTCTCGCCGGAGGAGATCAGCACGCACGACCGAGGTGATGGCCATCTGTAGCAGCTGCCACACGGAGCCTTTCCAGGGTGCCATAGGGTGCCATCGTGTTTTCGTGGAATCAAGGGCCTCAGTGTGGGTCCATGGGGTCCATGTGGTAACTTCTAGTTGTCTAGTTGTTCCCAAAGTTCGGATAAACATTCTAGTGTCCTAGGACCCCAATTCGATTGGTTGGGCATCTTGTGCATCTTGTGCCACAATTGTCCATGTGGTCCATGTGGGAGTCAACGCTTTACAACGCTTTACTGTTGCCACCCATTTAAACAATCCTTGACTCGCTCATGGA

Full Affymetrix probeset data:

Annotations for 1624724_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720