Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624725_at:

>probe:Drosophila_2:1624725_at:151:359; Interrogation_Position=4818; Antisense; GCAAACCCTAATGGCCGATGTCATA
>probe:Drosophila_2:1624725_at:390:319; Interrogation_Position=4831; Antisense; GCCGATGTCATAGCCATACCACAGG
>probe:Drosophila_2:1624725_at:639:25; Interrogation_Position=4846; Antisense; ATACCACAGGCTTTCGGAACGGAGA
>probe:Drosophila_2:1624725_at:117:87; Interrogation_Position=4882; Antisense; AGTCCCACAGGACGAAATGTCTCAA
>probe:Drosophila_2:1624725_at:40:61; Interrogation_Position=4898; Antisense; ATGTCTCAAAGTCGCAGAGCACGCC
>probe:Drosophila_2:1624725_at:390:573; Interrogation_Position=4926; Antisense; GGCTGCTGGACCTTCGAATATCAAT
>probe:Drosophila_2:1624725_at:289:223; Interrogation_Position=4955; Antisense; AAGGGATTCCCAAGTCGCTGAGCGA
>probe:Drosophila_2:1624725_at:163:249; Interrogation_Position=4981; Antisense; CAATATGTCCGCCAGCTCAAGGAGA
>probe:Drosophila_2:1624725_at:382:415; Interrogation_Position=5004; Antisense; GAGCGACGTCTAGTCAGATTCCCAG
>probe:Drosophila_2:1624725_at:154:267; Interrogation_Position=5026; Antisense; CAGTCTCCAGTCCAGAATCTAGTCA
>probe:Drosophila_2:1624725_at:631:183; Interrogation_Position=5134; Antisense; AAAAGATGTCAGGTTCTCAGAACTC
>probe:Drosophila_2:1624725_at:40:241; Interrogation_Position=5184; Antisense; AATAATTAGCGACCGTGTGCAGTAA
>probe:Drosophila_2:1624725_at:186:457; Interrogation_Position=5215; Antisense; GATACTCAACGAGCCATTTGCGAAG
>probe:Drosophila_2:1624725_at:723:533; Interrogation_Position=5283; Antisense; GGTGTAGTCACTAAATCCACATTTT

Paste this into a BLAST search page for me
GCAAACCCTAATGGCCGATGTCATAGCCGATGTCATAGCCATACCACAGGATACCACAGGCTTTCGGAACGGAGAAGTCCCACAGGACGAAATGTCTCAAATGTCTCAAAGTCGCAGAGCACGCCGGCTGCTGGACCTTCGAATATCAATAAGGGATTCCCAAGTCGCTGAGCGACAATATGTCCGCCAGCTCAAGGAGAGAGCGACGTCTAGTCAGATTCCCAGCAGTCTCCAGTCCAGAATCTAGTCAAAAAGATGTCAGGTTCTCAGAACTCAATAATTAGCGACCGTGTGCAGTAAGATACTCAACGAGCCATTTGCGAAGGGTGTAGTCACTAAATCCACATTTT

Full Affymetrix probeset data:

Annotations for 1624725_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime