Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624729_at:

>probe:Drosophila_2:1624729_at:255:45; Interrogation_Position=1815; Antisense; ATCCCCAAGGTCTGCTCGAATTGAG
>probe:Drosophila_2:1624729_at:672:667; Interrogation_Position=1856; Antisense; TACTATGACAGCGAAATGCCGCCGC
>probe:Drosophila_2:1624729_at:419:517; Interrogation_Position=1898; Antisense; GTGGTCGTTGAATCGCCGCCAGCTT
>probe:Drosophila_2:1624729_at:218:257; Interrogation_Position=1929; Antisense; CACTTGCAGTGGTTACACCTGTGGT
>probe:Drosophila_2:1624729_at:546:665; Interrogation_Position=1942; Antisense; TACACCTGTGGTGCAACTGCGACGT
>probe:Drosophila_2:1624729_at:151:195; Interrogation_Position=1956; Antisense; AACTGCGACGTGGAAAGCTGCGATC
>probe:Drosophila_2:1624729_at:647:135; Interrogation_Position=2018; Antisense; ACGAAGAAGAGCATTCCACCGCCAA
>probe:Drosophila_2:1624729_at:325:441; Interrogation_Position=2096; Antisense; GATGGCAAGCTCCAGTGTCCACAGT
>probe:Drosophila_2:1624729_at:292:85; Interrogation_Position=2109; Antisense; AGTGTCCACAGTGTCCGAACGCCTA
>probe:Drosophila_2:1624729_at:484:305; Interrogation_Position=2130; Antisense; CCTACACCAGGTTATCCGCATTGAA
>probe:Drosophila_2:1624729_at:706:709; Interrogation_Position=2150; Antisense; TTGAAACGGCACCTGGAGTTCGAGT
>probe:Drosophila_2:1624729_at:383:637; Interrogation_Position=2169; Antisense; TCGAGTGCGGTATGCTGGAGAACTT
>probe:Drosophila_2:1624729_at:179:5; Interrogation_Position=2187; Antisense; AGAACTTCCGGTGTCAGGTTTGCGA
>probe:Drosophila_2:1624729_at:246:75; Interrogation_Position=2229; Antisense; AGGACTCGCTTAATCGGCATTGCAA

Paste this into a BLAST search page for me
ATCCCCAAGGTCTGCTCGAATTGAGTACTATGACAGCGAAATGCCGCCGCGTGGTCGTTGAATCGCCGCCAGCTTCACTTGCAGTGGTTACACCTGTGGTTACACCTGTGGTGCAACTGCGACGTAACTGCGACGTGGAAAGCTGCGATCACGAAGAAGAGCATTCCACCGCCAAGATGGCAAGCTCCAGTGTCCACAGTAGTGTCCACAGTGTCCGAACGCCTACCTACACCAGGTTATCCGCATTGAATTGAAACGGCACCTGGAGTTCGAGTTCGAGTGCGGTATGCTGGAGAACTTAGAACTTCCGGTGTCAGGTTTGCGAAGGACTCGCTTAATCGGCATTGCAA

Full Affymetrix probeset data:

Annotations for 1624729_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime