FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624732_at:

>probe:Drosophila_2:1624732_at:358:687; Interrogation_Position=117; Antisense; TATTTCGGGTCAGGAGCAGCTTTCT
>probe:Drosophila_2:1624732_at:540:357; Interrogation_Position=168; Antisense; GCACACGGTGCCAACACTGGAGGAT
>probe:Drosophila_2:1624732_at:64:591; Interrogation_Position=195; Antisense; TGGTAACTACATTTGGGACTCGCAT
>probe:Drosophila_2:1624732_at:34:557; Interrogation_Position=210; Antisense; GGACTCGCATGCCATTATCGCGTAT
>probe:Drosophila_2:1624732_at:455:683; Interrogation_Position=247; Antisense; TATGCAGATTCGGATGCCCTGTATC
>probe:Drosophila_2:1624732_at:382:519; Interrogation_Position=298; Antisense; GTGGATCAACGACTGCACTTCGAGA
>probe:Drosophila_2:1624732_at:653:153; Interrogation_Position=322; Antisense; ACAGGAGTGGTTTTCGCCAATGGCA
>probe:Drosophila_2:1624732_at:582:121; Interrogation_Position=362; Antisense; AGCCGTTATTCTTTAATGGCCTGAA
>probe:Drosophila_2:1624732_at:314:379; Interrogation_Position=400; Antisense; GAACGCTACGATGCCATTGTCGAGA
>probe:Drosophila_2:1624732_at:34:679; Interrogation_Position=427; Antisense; TATGACTTTGTGGAGACCTTCCTCG
>probe:Drosophila_2:1624732_at:8:17; Interrogation_Position=494; Antisense; ATTTTAGCCTGATCTCGTCGATTAC
>probe:Drosophila_2:1624732_at:159:481; Interrogation_Position=584; Antisense; GTTTGGAGAAGCTGCCTTACTACGA
>probe:Drosophila_2:1624732_at:516:87; Interrogation_Position=653; Antisense; AGTCCACTAATTTCACCTTTGCAAC
>probe:Drosophila_2:1624732_at:509:629; Interrogation_Position=86; Antisense; TCCAGCTGCCCTATGAGTTTGTAAA

Paste this into a BLAST search page for me
TATTTCGGGTCAGGAGCAGCTTTCTGCACACGGTGCCAACACTGGAGGATTGGTAACTACATTTGGGACTCGCATGGACTCGCATGCCATTATCGCGTATTATGCAGATTCGGATGCCCTGTATCGTGGATCAACGACTGCACTTCGAGAACAGGAGTGGTTTTCGCCAATGGCAAGCCGTTATTCTTTAATGGCCTGAAGAACGCTACGATGCCATTGTCGAGATATGACTTTGTGGAGACCTTCCTCGATTTTAGCCTGATCTCGTCGATTACGTTTGGAGAAGCTGCCTTACTACGAAGTCCACTAATTTCACCTTTGCAACTCCAGCTGCCCTATGAGTTTGTAAA

Full Affymetrix probeset data:

Annotations for 1624732_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720