Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624738_at:

>probe:Drosophila_2:1624738_at:144:57; Interrogation_Position=239; Antisense; ATGAGGTTATCCCTGTTAAGCTGCA
>probe:Drosophila_2:1624738_at:417:79; Interrogation_Position=242; Antisense; AGGTTATCCCTGTTAAGCTGCAGCG
>probe:Drosophila_2:1624738_at:91:705; Interrogation_Position=245; Antisense; TTATCCCTGTTAAGCTGCAGCGCAG
>probe:Drosophila_2:1624738_at:26:303; Interrogation_Position=366; Antisense; CCGCCGTTTGCGTCTCCTGAAGAAG
>probe:Drosophila_2:1624738_at:582:57; Interrogation_Position=578; Antisense; ATGAGGTCATCCCTGTTAAGCTGCA
>probe:Drosophila_2:1624738_at:242:79; Interrogation_Position=581; Antisense; AGGTCATCCCTGTTAAGCTGCAGCG
>probe:Drosophila_2:1624738_at:716:647; Interrogation_Position=584; Antisense; TCATCCCTGTTAAGCTGCAGCGCAG
>probe:Drosophila_2:1624738_at:58:251; Interrogation_Position=696; Antisense; CAACCGCGGCCGTTATGTCACCATT
>probe:Drosophila_2:1624738_at:514:577; Interrogation_Position=703; Antisense; GGCCGTTATGTCACCATTCGCAAGC
>probe:Drosophila_2:1624738_at:574:475; Interrogation_Position=707; Antisense; GTTATGTCACCATTCGCAAGCCGAA
>probe:Drosophila_2:1624738_at:711:681; Interrogation_Position=709; Antisense; TATGTCACCATTCGCAAGCCGAAAA
>probe:Drosophila_2:1624738_at:508:359; Interrogation_Position=722; Antisense; GCAAGCCGAAAAGCTCTGTCTTCAG
>probe:Drosophila_2:1624738_at:84:389; Interrogation_Position=729; Antisense; GAAAAGCTCTGTCTTCAGCGGCAAG
>probe:Drosophila_2:1624738_at:667:207; Interrogation_Position=732; Antisense; AAGCTCTGTCTTCAGCGGCAAGAAG

Paste this into a BLAST search page for me
ATGAGGTTATCCCTGTTAAGCTGCAAGGTTATCCCTGTTAAGCTGCAGCGTTATCCCTGTTAAGCTGCAGCGCAGCCGCCGTTTGCGTCTCCTGAAGAAGATGAGGTCATCCCTGTTAAGCTGCAAGGTCATCCCTGTTAAGCTGCAGCGTCATCCCTGTTAAGCTGCAGCGCAGCAACCGCGGCCGTTATGTCACCATTGGCCGTTATGTCACCATTCGCAAGCGTTATGTCACCATTCGCAAGCCGAATATGTCACCATTCGCAAGCCGAAAAGCAAGCCGAAAAGCTCTGTCTTCAGGAAAAGCTCTGTCTTCAGCGGCAAGAAGCTCTGTCTTCAGCGGCAAGAAG

Full Affymetrix probeset data:

Annotations for 1624738_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime