Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624739_at:

>probe:Drosophila_2:1624739_at:628:447; Interrogation_Position=1173; Antisense; GATGCCCGATCGTCTAGCCAAGCAG
>probe:Drosophila_2:1624739_at:278:127; Interrogation_Position=1188; Antisense; AGCCAAGCAGTATCAATCGTCACCC
>probe:Drosophila_2:1624739_at:720:125; Interrogation_Position=1227; Antisense; AGCCTACCAGGCTTTGAGGGAGAAA
>probe:Drosophila_2:1624739_at:651:393; Interrogation_Position=1248; Antisense; GAAATATTTGGGTCCGGACTCTGGA
>probe:Drosophila_2:1624739_at:20:145; Interrogation_Position=1265; Antisense; ACTCTGGACAGGATTGCAGGGCCAT
>probe:Drosophila_2:1624739_at:56:591; Interrogation_Position=1308; Antisense; TGGTCCACCATGCAAGCGAGACGTT
>probe:Drosophila_2:1624739_at:472:271; Interrogation_Position=1397; Antisense; CATCGTTCGGCGGACATGGTCATCA
>probe:Drosophila_2:1624739_at:494:399; Interrogation_Position=1439; Antisense; GACACGGACATTGCTTGACCAGTAA
>probe:Drosophila_2:1624739_at:706:273; Interrogation_Position=1452; Antisense; CTTGACCAGTAAGGCGGCATTTCGC
>probe:Drosophila_2:1624739_at:640:317; Interrogation_Position=1477; Antisense; GCCGGAGTGCCCAAGCATAATGCCT
>probe:Drosophila_2:1624739_at:481:233; Interrogation_Position=1495; Antisense; AATGCCTCCGGTGATTTCGTGGGAA
>probe:Drosophila_2:1624739_at:66:15; Interrogation_Position=1604; Antisense; ATTACGACATCGAAACCCTGGTGCC
>probe:Drosophila_2:1624739_at:713:331; Interrogation_Position=1664; Antisense; GCGGCTATCCAGAGCACTGGCGATT
>probe:Drosophila_2:1624739_at:573:465; Interrogation_Position=1685; Antisense; GATTGGCCAGTGTCTATCAGCACGC

Paste this into a BLAST search page for me
GATGCCCGATCGTCTAGCCAAGCAGAGCCAAGCAGTATCAATCGTCACCCAGCCTACCAGGCTTTGAGGGAGAAAGAAATATTTGGGTCCGGACTCTGGAACTCTGGACAGGATTGCAGGGCCATTGGTCCACCATGCAAGCGAGACGTTCATCGTTCGGCGGACATGGTCATCAGACACGGACATTGCTTGACCAGTAACTTGACCAGTAAGGCGGCATTTCGCGCCGGAGTGCCCAAGCATAATGCCTAATGCCTCCGGTGATTTCGTGGGAAATTACGACATCGAAACCCTGGTGCCGCGGCTATCCAGAGCACTGGCGATTGATTGGCCAGTGTCTATCAGCACGC

Full Affymetrix probeset data:

Annotations for 1624739_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime