Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624745_at:

>probe:Drosophila_2:1624745_at:260:67; Interrogation_Position=112; Antisense; ATGGACATGCTGAGGGTTGCCTGTC
>probe:Drosophila_2:1624745_at:426:539; Interrogation_Position=126; Antisense; GGTTGCCTGTCCCAATGGATTCAAT
>probe:Drosophila_2:1624745_at:409:543; Interrogation_Position=142; Antisense; GGATTCAATTCAATGTTCGCCAAAC
>probe:Drosophila_2:1624745_at:647:59; Interrogation_Position=154; Antisense; ATGTTCGCCAAACGAGGCACCTTGG
>probe:Drosophila_2:1624745_at:600:353; Interrogation_Position=170; Antisense; GCACCTTGGGCCTATTCGATTATGA
>probe:Drosophila_2:1624745_at:189:459; Interrogation_Position=187; Antisense; GATTATGAGGACCACTTGGCGGATT
>probe:Drosophila_2:1624745_at:157:21; Interrogation_Position=209; Antisense; ATTTGGATAGCTCCGAATCTCACCA
>probe:Drosophila_2:1624745_at:307:367; Interrogation_Position=223; Antisense; GAATCTCACCACATGAACTCACTGT
>probe:Drosophila_2:1624745_at:287:143; Interrogation_Position=243; Antisense; ACTGTCGAGCATTCGGCGCGATTTT
>probe:Drosophila_2:1624745_at:177:17; Interrogation_Position=263; Antisense; ATTTTCGCGGCGTTGTCGACTCCTG
>probe:Drosophila_2:1624745_at:245:601; Interrogation_Position=286; Antisense; TGTTGCCGCAAATCGTGTTCCTTTT
>probe:Drosophila_2:1624745_at:68:513; Interrogation_Position=300; Antisense; GTGTTCCTTTTCCACGTTGAGGGCA
>probe:Drosophila_2:1624745_at:279:467; Interrogation_Position=315; Antisense; GTTGAGGGCATACTGCGACTCCTAA
>probe:Drosophila_2:1624745_at:638:727; Interrogation_Position=96; Antisense; TTGTGGCCCCGCCTTGATGGACATG

Paste this into a BLAST search page for me
ATGGACATGCTGAGGGTTGCCTGTCGGTTGCCTGTCCCAATGGATTCAATGGATTCAATTCAATGTTCGCCAAACATGTTCGCCAAACGAGGCACCTTGGGCACCTTGGGCCTATTCGATTATGAGATTATGAGGACCACTTGGCGGATTATTTGGATAGCTCCGAATCTCACCAGAATCTCACCACATGAACTCACTGTACTGTCGAGCATTCGGCGCGATTTTATTTTCGCGGCGTTGTCGACTCCTGTGTTGCCGCAAATCGTGTTCCTTTTGTGTTCCTTTTCCACGTTGAGGGCAGTTGAGGGCATACTGCGACTCCTAATTGTGGCCCCGCCTTGATGGACATG

Full Affymetrix probeset data:

Annotations for 1624745_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime