FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624746_at:

>probe:Drosophila_2:1624746_at:510:457; Interrogation_Position=1305; Antisense; GATATTCCGCCCAGAGGTCTCAAGA
>probe:Drosophila_2:1624746_at:516:435; Interrogation_Position=1318; Antisense; GAGGTCTCAAGATGTCGGCCACCTT
>probe:Drosophila_2:1624746_at:335:133; Interrogation_Position=1356; Antisense; ACCGCCATTCAGGAGCTATTCAAAC
>probe:Drosophila_2:1624746_at:151:651; Interrogation_Position=1375; Antisense; TCAAACGGGTTTCGGAGCAGTTCAC
>probe:Drosophila_2:1624746_at:716:91; Interrogation_Position=1393; Antisense; AGTTCACCGCCATGTTCCGAAGGAA
>probe:Drosophila_2:1624746_at:711:225; Interrogation_Position=1412; Antisense; AAGGAAGGCCTTCTTGCATTGGTAC
>probe:Drosophila_2:1624746_at:74:543; Interrogation_Position=1586; Antisense; GGATTAACTTCCCACTCAAGATCAC
>probe:Drosophila_2:1624746_at:508:381; Interrogation_Position=1639; Antisense; GAACCCATTAGGAAGGCACAACACA
>probe:Drosophila_2:1624746_at:193:151; Interrogation_Position=1661; Antisense; ACATTGGATCTTTGGGCCTTAGCAT
>probe:Drosophila_2:1624746_at:378:675; Interrogation_Position=1680; Antisense; TAGCATATTGTGCTTCGAGGCCCGT
>probe:Drosophila_2:1624746_at:262:437; Interrogation_Position=1696; Antisense; GAGGCCCGTCGGTTGTACATATTTC
>probe:Drosophila_2:1624746_at:318:25; Interrogation_Position=1723; Antisense; ATATGGATTCTTCACTGTTCGATTA
>probe:Drosophila_2:1624746_at:73:63; Interrogation_Position=1777; Antisense; ATGTCCACCTTTGTTAAGCTCATGT
>probe:Drosophila_2:1624746_at:96:363; Interrogation_Position=1803; Antisense; GCAATTGCTGTGATTTCTGGGTTAC

Paste this into a BLAST search page for me
GATATTCCGCCCAGAGGTCTCAAGAGAGGTCTCAAGATGTCGGCCACCTTACCGCCATTCAGGAGCTATTCAAACTCAAACGGGTTTCGGAGCAGTTCACAGTTCACCGCCATGTTCCGAAGGAAAAGGAAGGCCTTCTTGCATTGGTACGGATTAACTTCCCACTCAAGATCACGAACCCATTAGGAAGGCACAACACAACATTGGATCTTTGGGCCTTAGCATTAGCATATTGTGCTTCGAGGCCCGTGAGGCCCGTCGGTTGTACATATTTCATATGGATTCTTCACTGTTCGATTAATGTCCACCTTTGTTAAGCTCATGTGCAATTGCTGTGATTTCTGGGTTAC

Full Affymetrix probeset data:

Annotations for 1624746_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720