Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624747_at:

>probe:Drosophila_2:1624747_at:627:151; Interrogation_Position=1015; Antisense; ACATGGCCGTGTAGGCGACCTTGAA
>probe:Drosophila_2:1624747_at:9:243; Interrogation_Position=1043; Antisense; AATAGTTCTGGCTTACTTGAGCAAG
>probe:Drosophila_2:1624747_at:250:361; Interrogation_Position=1070; Antisense; GAATCTTCAACTGAGTAGGTCGCTC
>probe:Drosophila_2:1624747_at:631:79; Interrogation_Position=1086; Antisense; AGGTCGCTCACAAATATCTTACTTT
>probe:Drosophila_2:1624747_at:283:703; Interrogation_Position=1233; Antisense; TTTTGCTTTCATTCATCGTGTGTAG
>probe:Drosophila_2:1624747_at:230:57; Interrogation_Position=741; Antisense; ATGGGCCTGGGCGTACCCTTCAACA
>probe:Drosophila_2:1624747_at:72:465; Interrogation_Position=794; Antisense; GATTGCCCATGTGACGGGTCTGAAG
>probe:Drosophila_2:1624747_at:319:613; Interrogation_Position=814; Antisense; TGAAGCCGGGCGACTTTGTTCACAC
>probe:Drosophila_2:1624747_at:578:403; Interrogation_Position=825; Antisense; GACTTTGTTCACACCATGGGCGACA
>probe:Drosophila_2:1624747_at:293:593; Interrogation_Position=841; Antisense; TGGGCGACACACACGTCTACCTGAA
>probe:Drosophila_2:1624747_at:362:131; Interrogation_Position=859; Antisense; ACCTGAACCACGTAGAGCCGCTGAA
>probe:Drosophila_2:1624747_at:624:693; Interrogation_Position=912; Antisense; TTTCCCAAGCTGATCATTAAACGTC
>probe:Drosophila_2:1624747_at:360:267; Interrogation_Position=942; Antisense; CAGGACATCGAGGACTTCCGCTTCG
>probe:Drosophila_2:1624747_at:342:719; Interrogation_Position=957; Antisense; TTCCGCTTCGAGGACTTTCAGATAG

Paste this into a BLAST search page for me
ACATGGCCGTGTAGGCGACCTTGAAAATAGTTCTGGCTTACTTGAGCAAGGAATCTTCAACTGAGTAGGTCGCTCAGGTCGCTCACAAATATCTTACTTTTTTTGCTTTCATTCATCGTGTGTAGATGGGCCTGGGCGTACCCTTCAACAGATTGCCCATGTGACGGGTCTGAAGTGAAGCCGGGCGACTTTGTTCACACGACTTTGTTCACACCATGGGCGACATGGGCGACACACACGTCTACCTGAAACCTGAACCACGTAGAGCCGCTGAATTTCCCAAGCTGATCATTAAACGTCCAGGACATCGAGGACTTCCGCTTCGTTCCGCTTCGAGGACTTTCAGATAG

Full Affymetrix probeset data:

Annotations for 1624747_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime