FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624749_at:

>probe:Drosophila_2:1624749_at:696:11; Interrogation_Position=1003; Antisense; ATTCAGTATCCGGATTTTGGCCTCT
>probe:Drosophila_2:1624749_at:76:249; Interrogation_Position=1060; Antisense; CAATTGGGTCTGATTCTGCCGGGAA
>probe:Drosophila_2:1624749_at:424:363; Interrogation_Position=1082; Antisense; GAATTGTGGACATCTGCCTTCGCTA
>probe:Drosophila_2:1624749_at:3:557; Interrogation_Position=1113; Antisense; GGACTACGGTCCTGGCAAGATCTTT
>probe:Drosophila_2:1624749_at:611:713; Interrogation_Position=1136; Antisense; TTCTCATCCGATCCATGCTATTTAT
>probe:Drosophila_2:1624749_at:494:717; Interrogation_Position=1184; Antisense; TTGCTGGTACAGTGGTAACCCTACA
>probe:Drosophila_2:1624749_at:649:277; Interrogation_Position=1215; Antisense; CTACGCTCGCTATCCAGTTGTAAGA
>probe:Drosophila_2:1624749_at:602:245; Interrogation_Position=723; Antisense; AATTAGCTTCTATGCTGTCTTCGGC
>probe:Drosophila_2:1624749_at:111:335; Interrogation_Position=736; Antisense; GCTGTCTTCGGCTTTTTTGGATATT
>probe:Drosophila_2:1624749_at:573:241; Interrogation_Position=775; Antisense; AATACGTCCAATTCGATTCTGCAGA
>probe:Drosophila_2:1624749_at:132:407; Interrogation_Position=834; Antisense; GACTGGCATATTTGCTCTCGCAATA
>probe:Drosophila_2:1624749_at:684:243; Interrogation_Position=855; Antisense; AATATTCTTTAGTTATGCCCTGCAA
>probe:Drosophila_2:1624749_at:443:499; Interrogation_Position=959; Antisense; GTCTGCTGAGAATTGCGCTGGTAAT
>probe:Drosophila_2:1624749_at:490:493; Interrogation_Position=979; Antisense; GTAATCGCATCCGTGCTGGTGGCAA

Paste this into a BLAST search page for me
ATTCAGTATCCGGATTTTGGCCTCTCAATTGGGTCTGATTCTGCCGGGAAGAATTGTGGACATCTGCCTTCGCTAGGACTACGGTCCTGGCAAGATCTTTTTCTCATCCGATCCATGCTATTTATTTGCTGGTACAGTGGTAACCCTACACTACGCTCGCTATCCAGTTGTAAGAAATTAGCTTCTATGCTGTCTTCGGCGCTGTCTTCGGCTTTTTTGGATATTAATACGTCCAATTCGATTCTGCAGAGACTGGCATATTTGCTCTCGCAATAAATATTCTTTAGTTATGCCCTGCAAGTCTGCTGAGAATTGCGCTGGTAATGTAATCGCATCCGTGCTGGTGGCAA

Full Affymetrix probeset data:

Annotations for 1624749_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720