Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624750_at:

>probe:Drosophila_2:1624750_at:352:163; Interrogation_Position=2375; Antisense; AAATTCAAGCGAGTCACCTTCCAAG
>probe:Drosophila_2:1624750_at:557:127; Interrogation_Position=2390; Antisense; ACCTTCCAAGTCTGCACCTAAACAA
>probe:Drosophila_2:1624750_at:331:387; Interrogation_Position=2429; Antisense; GAAAACCACTGTTTCCAATTCAGAT
>probe:Drosophila_2:1624750_at:432:229; Interrogation_Position=2499; Antisense; AATGGAGCCGGATCACCAGCTAAAC
>probe:Drosophila_2:1624750_at:452:145; Interrogation_Position=2557; Antisense; ACTCCCCTAGCAAATCAGCAATTAA
>probe:Drosophila_2:1624750_at:46:387; Interrogation_Position=2588; Antisense; GAAAACGAAGCCACAGCCGAAAGGA
>probe:Drosophila_2:1624750_at:246:251; Interrogation_Position=2645; Antisense; CAAGGCGCCGCGAGTGGATATCGAC
>probe:Drosophila_2:1624750_at:98:543; Interrogation_Position=2660; Antisense; GGATATCGACGATGTGCCCATTCTC
>probe:Drosophila_2:1624750_at:471:321; Interrogation_Position=2674; Antisense; TGCCCATTCTCGAGGGAAAACCCAT
>probe:Drosophila_2:1624750_at:658:233; Interrogation_Position=2725; Antisense; AATCCAAACAGATCGGCCAGCTGAA
>probe:Drosophila_2:1624750_at:255:309; Interrogation_Position=2741; Antisense; CCAGCTGAAAAAGTCCACGGCGGGT
>probe:Drosophila_2:1624750_at:230:511; Interrogation_Position=2798; Antisense; GTGAACACCTTAGATCCAGTTTTGT
>probe:Drosophila_2:1624750_at:703:501; Interrogation_Position=2860; Antisense; GTCCCGACGCGATTACCAATTTTAT
>probe:Drosophila_2:1624750_at:15:723; Interrogation_Position=2886; Antisense; TTGCGAACTGTCTTAGCGAACGATT

Paste this into a BLAST search page for me
AAATTCAAGCGAGTCACCTTCCAAGACCTTCCAAGTCTGCACCTAAACAAGAAAACCACTGTTTCCAATTCAGATAATGGAGCCGGATCACCAGCTAAACACTCCCCTAGCAAATCAGCAATTAAGAAAACGAAGCCACAGCCGAAAGGACAAGGCGCCGCGAGTGGATATCGACGGATATCGACGATGTGCCCATTCTCTGCCCATTCTCGAGGGAAAACCCATAATCCAAACAGATCGGCCAGCTGAACCAGCTGAAAAAGTCCACGGCGGGTGTGAACACCTTAGATCCAGTTTTGTGTCCCGACGCGATTACCAATTTTATTTGCGAACTGTCTTAGCGAACGATT

Full Affymetrix probeset data:

Annotations for 1624750_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime