FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624751_at:

>probe:Drosophila_2:1624751_at:647:163; Interrogation_Position=1006; Antisense; AAATCTGCAGCTGCCTTGACAATCA
>probe:Drosophila_2:1624751_at:192:239; Interrogation_Position=1026; Antisense; AATCACCACGTTGGCCATCGATAAG
>probe:Drosophila_2:1624751_at:482:559; Interrogation_Position=1050; Antisense; GGACAAGAATCTCCTGTGCTATCTT
>probe:Drosophila_2:1624751_at:638:93; Interrogation_Position=1097; Antisense; AGTTCTGCAATTTACTCTTCTGCCA
>probe:Drosophila_2:1624751_at:32:65; Interrogation_Position=1172; Antisense; ATGTGGATCCATCTTTCTCGGCAGA
>probe:Drosophila_2:1624751_at:475:435; Interrogation_Position=1195; Antisense; GAGGTGTCCGGCATCATCGAATGGA
>probe:Drosophila_2:1624751_at:589:35; Interrogation_Position=1291; Antisense; ATCATTGGTAACTACTTTCCCGCCA
>probe:Drosophila_2:1624751_at:428:319; Interrogation_Position=760; Antisense; GCCGCACTGCAAGCCCTAATAAATA
>probe:Drosophila_2:1624751_at:103:323; Interrogation_Position=819; Antisense; GCTTAACAATAACCTTTTGCCCCAT
>probe:Drosophila_2:1624751_at:230:307; Interrogation_Position=840; Antisense; CCATTTATCGGCTCTGATGTCCAAT
>probe:Drosophila_2:1624751_at:467:513; Interrogation_Position=866; Antisense; GTGATCCAGATATTCGCTGTCAAGT
>probe:Drosophila_2:1624751_at:210:701; Interrogation_Position=899; Antisense; TTTTGCTAAACATCGCTGACGGAAA
>probe:Drosophila_2:1624751_at:611:243; Interrogation_Position=922; Antisense; AATATATTCCAAAGGCACGCCATTA
>probe:Drosophila_2:1624751_at:280:307; Interrogation_Position=940; Antisense; GCCATTATGAATGCAGGTCTCCTGC

Paste this into a BLAST search page for me
AAATCTGCAGCTGCCTTGACAATCAAATCACCACGTTGGCCATCGATAAGGGACAAGAATCTCCTGTGCTATCTTAGTTCTGCAATTTACTCTTCTGCCAATGTGGATCCATCTTTCTCGGCAGAGAGGTGTCCGGCATCATCGAATGGAATCATTGGTAACTACTTTCCCGCCAGCCGCACTGCAAGCCCTAATAAATAGCTTAACAATAACCTTTTGCCCCATCCATTTATCGGCTCTGATGTCCAATGTGATCCAGATATTCGCTGTCAAGTTTTTGCTAAACATCGCTGACGGAAAAATATATTCCAAAGGCACGCCATTAGCCATTATGAATGCAGGTCTCCTGC

Full Affymetrix probeset data:

Annotations for 1624751_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720