Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624752_at:

>probe:Drosophila_2:1624752_at:359:619; Interrogation_Position=1654; Antisense; TGCATCTCCTTGTTGGCTCTGTATA
>probe:Drosophila_2:1624752_at:661:311; Interrogation_Position=1719; Antisense; GCCAGAGGCTCCAGGCATCTATATG
>probe:Drosophila_2:1624752_at:460:583; Interrogation_Position=1742; Antisense; TGGATCTCAACCAGCATCGAAACGC
>probe:Drosophila_2:1624752_at:456:391; Interrogation_Position=1760; Antisense; GAAACGCCATGCAGGTTCCCGAAGT
>probe:Drosophila_2:1624752_at:232:37; Interrogation_Position=1789; Antisense; ATCTTCCGCTACAGTGGATCGCTTA
>probe:Drosophila_2:1624752_at:54:559; Interrogation_Position=1921; Antisense; GGCAGCAAATCGAGTTATTCCCCAG
>probe:Drosophila_2:1624752_at:319:477; Interrogation_Position=1934; Antisense; GTTATTCCCCAGTATCGCAGAACGG
>probe:Drosophila_2:1624752_at:312:409; Interrogation_Position=1989; Antisense; GACGTCAGGTGCTTTCAAGGTGCTC
>probe:Drosophila_2:1624752_at:463:287; Interrogation_Position=2017; Antisense; CTGGATTTCTCCATGCTGGGACACA
>probe:Drosophila_2:1624752_at:116:443; Interrogation_Position=2044; Antisense; GATGTGGCTGGATGTCGCACCCTGA
>probe:Drosophila_2:1624752_at:688:417; Interrogation_Position=2099; Antisense; GAGCTCGTTTGTTGTTGGCTAGCCC
>probe:Drosophila_2:1624752_at:213:29; Interrogation_Position=2136; Antisense; ATACGATACCCTCGTGCACAGTATG
>probe:Drosophila_2:1624752_at:498:483; Interrogation_Position=2156; Antisense; GTATGGCCCTTAGCGAAGGACCTTT
>probe:Drosophila_2:1624752_at:132:565; Interrogation_Position=2211; Antisense; GGAATATGCCAATGCCTGTCGAACA

Paste this into a BLAST search page for me
TGCATCTCCTTGTTGGCTCTGTATAGCCAGAGGCTCCAGGCATCTATATGTGGATCTCAACCAGCATCGAAACGCGAAACGCCATGCAGGTTCCCGAAGTATCTTCCGCTACAGTGGATCGCTTAGGCAGCAAATCGAGTTATTCCCCAGGTTATTCCCCAGTATCGCAGAACGGGACGTCAGGTGCTTTCAAGGTGCTCCTGGATTTCTCCATGCTGGGACACAGATGTGGCTGGATGTCGCACCCTGAGAGCTCGTTTGTTGTTGGCTAGCCCATACGATACCCTCGTGCACAGTATGGTATGGCCCTTAGCGAAGGACCTTTGGAATATGCCAATGCCTGTCGAACA

Full Affymetrix probeset data:

Annotations for 1624752_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime