Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624756_at:

>probe:Drosophila_2:1624756_at:352:123; Interrogation_Position=1962; Antisense; AGCGCAGACTGCCTATACGGAGCTT
>probe:Drosophila_2:1624756_at:16:685; Interrogation_Position=1975; Antisense; TATACGGAGCTTTTGGCCTTGTCGC
>probe:Drosophila_2:1624756_at:183:435; Interrogation_Position=2002; Antisense; GAGGTGTCCCCAGAACTAGCTGAAG
>probe:Drosophila_2:1624756_at:519:553; Interrogation_Position=2043; Antisense; GGAGCTGTATCTGGTAGACGCCTGC
>probe:Drosophila_2:1624756_at:478:403; Interrogation_Position=2083; Antisense; GACTTCTTGCGGTTCATTGATCTCA
>probe:Drosophila_2:1624756_at:486:435; Interrogation_Position=2131; Antisense; GAGGTTCGCCTGGAGAACTGCTTAA
>probe:Drosophila_2:1624756_at:378:11; Interrogation_Position=2148; Antisense; CTGCTTAAAACGATTCCGGCCGAAT
>probe:Drosophila_2:1624756_at:617:233; Interrogation_Position=2170; Antisense; AATGCCGTCAGCTTGGTGGACAGCT
>probe:Drosophila_2:1624756_at:464:399; Interrogation_Position=2188; Antisense; GACAGCTTTGATCTTCACGATCGCG
>probe:Drosophila_2:1624756_at:626:95; Interrogation_Position=2217; Antisense; AGATTCCGCATTGGGTGCCTATGAT
>probe:Drosophila_2:1624756_at:405:161; Interrogation_Position=2291; Antisense; ACAAGGAGCCAGTCAACGGAGCATT
>probe:Drosophila_2:1624756_at:601:139; Interrogation_Position=2306; Antisense; ACGGAGCATTCCACAAGTACTTGAA
>probe:Drosophila_2:1624756_at:358:371; Interrogation_Position=2340; Antisense; GAAGGCTCACCTCTAGATTCATATC
>probe:Drosophila_2:1624756_at:390:463; Interrogation_Position=2355; Antisense; GATTCATATCCTATTGCTCTGGAAG

Paste this into a BLAST search page for me
AGCGCAGACTGCCTATACGGAGCTTTATACGGAGCTTTTGGCCTTGTCGCGAGGTGTCCCCAGAACTAGCTGAAGGGAGCTGTATCTGGTAGACGCCTGCGACTTCTTGCGGTTCATTGATCTCAGAGGTTCGCCTGGAGAACTGCTTAACTGCTTAAAACGATTCCGGCCGAATAATGCCGTCAGCTTGGTGGACAGCTGACAGCTTTGATCTTCACGATCGCGAGATTCCGCATTGGGTGCCTATGATACAAGGAGCCAGTCAACGGAGCATTACGGAGCATTCCACAAGTACTTGAAGAAGGCTCACCTCTAGATTCATATCGATTCATATCCTATTGCTCTGGAAG

Full Affymetrix probeset data:

Annotations for 1624756_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime