Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624757_at:

>probe:Drosophila_2:1624757_at:568:455; Interrogation_Position=1528; Antisense; GATACGTATGGCTACCATTCGTCGA
>probe:Drosophila_2:1624757_at:395:273; Interrogation_Position=1543; Antisense; CATTCGTCGATCTCGTCGGTTTATA
>probe:Drosophila_2:1624757_at:293:33; Interrogation_Position=1588; Antisense; ATCACTAGCGTCTTCGATCATTTGC
>probe:Drosophila_2:1624757_at:470:453; Interrogation_Position=1603; Antisense; GATCATTTGCGCAACTTTACGGACG
>probe:Drosophila_2:1624757_at:548:489; Interrogation_Position=1663; Antisense; TTCGAAGTGGTTCATATCCGGGATT
>probe:Drosophila_2:1624757_at:331:143; Interrogation_Position=1698; Antisense; ACTGGACACTTCCTTCAGCGATGGA
>probe:Drosophila_2:1624757_at:620:585; Interrogation_Position=1719; Antisense; TGGAAAGGCTCGTATGCCGGTCACT
>probe:Drosophila_2:1624757_at:420:447; Interrogation_Position=1747; Antisense; GATGCCCAGCTAATTACGTTTACCT
>probe:Drosophila_2:1624757_at:614:131; Interrogation_Position=1762; Antisense; ACGTTTACCTTCACCAATGGCTATG
>probe:Drosophila_2:1624757_at:682:227; Interrogation_Position=1777; Antisense; AATGGCTATGTGGTTACCCTGCGAT
>probe:Drosophila_2:1624757_at:256:325; Interrogation_Position=1797; Antisense; GCGATCGGCACCCAACGATATTAAG
>probe:Drosophila_2:1624757_at:238:711; Interrogation_Position=1829; Antisense; TTAATGCGGAGATCTGTGGCTTGCC
>probe:Drosophila_2:1624757_at:172:549; Interrogation_Position=1914; Antisense; GGAGGAGTTTCTTCAACCAGAGGAG
>probe:Drosophila_2:1624757_at:599:229; Interrogation_Position=1939; Antisense; AATGGTCTTACGGATGCCTCAACAA

Paste this into a BLAST search page for me
GATACGTATGGCTACCATTCGTCGACATTCGTCGATCTCGTCGGTTTATAATCACTAGCGTCTTCGATCATTTGCGATCATTTGCGCAACTTTACGGACGTTCGAAGTGGTTCATATCCGGGATTACTGGACACTTCCTTCAGCGATGGATGGAAAGGCTCGTATGCCGGTCACTGATGCCCAGCTAATTACGTTTACCTACGTTTACCTTCACCAATGGCTATGAATGGCTATGTGGTTACCCTGCGATGCGATCGGCACCCAACGATATTAAGTTAATGCGGAGATCTGTGGCTTGCCGGAGGAGTTTCTTCAACCAGAGGAGAATGGTCTTACGGATGCCTCAACAA

Full Affymetrix probeset data:

Annotations for 1624757_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime