FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624758_at:

>probe:Drosophila_2:1624758_at:550:369; Interrogation_Position=132; Antisense; GAAGGATCCTTTTCCCAAGACCATT
>probe:Drosophila_2:1624758_at:494:211; Interrogation_Position=148; Antisense; AAGACCATTTGCCAGTCTTGTGCGC
>probe:Drosophila_2:1624758_at:670:623; Interrogation_Position=177; Antisense; TGCGCAGACTGCTTACGGGATGGAC
>probe:Drosophila_2:1624758_at:396:369; Interrogation_Position=267; Antisense; GAATGACTCCGATGTTGAACTGATT
>probe:Drosophila_2:1624758_at:246:723; Interrogation_Position=326; Antisense; TTGACTTGACAATCGATTCACCGGG
>probe:Drosophila_2:1624758_at:300:519; Interrogation_Position=358; Antisense; GTGGAGAATATGTGCCCCAACTCAA
>probe:Drosophila_2:1624758_at:513:217; Interrogation_Position=478; Antisense; AAGTATTTCATGTTACCTGCGCACC
>probe:Drosophila_2:1624758_at:98:63; Interrogation_Position=514; Antisense; ATGTGGGTCCATGCGCGTGAAAAAC
>probe:Drosophila_2:1624758_at:426:159; Interrogation_Position=542; Antisense; ACAAATGCTTACAATGCTCCCAGTC
>probe:Drosophila_2:1624758_at:3:167; Interrogation_Position=575; Antisense; AAATCCGCGGTCTTAGGCGCCATGA
>probe:Drosophila_2:1624758_at:161:417; Interrogation_Position=598; Antisense; GAGCGCGTACATAGTTCGAGACCTG
>probe:Drosophila_2:1624758_at:478:425; Interrogation_Position=615; Antisense; GAGACCTGAATTACGATCCTACAAG
>probe:Drosophila_2:1624758_at:697:389; Interrogation_Position=668; Antisense; GAAACTCTGCCCTTAAGAACCACGA
>probe:Drosophila_2:1624758_at:9:381; Interrogation_Position=684; Antisense; GAACCACGAGACCATGCACCATAAT

Paste this into a BLAST search page for me
GAAGGATCCTTTTCCCAAGACCATTAAGACCATTTGCCAGTCTTGTGCGCTGCGCAGACTGCTTACGGGATGGACGAATGACTCCGATGTTGAACTGATTTTGACTTGACAATCGATTCACCGGGGTGGAGAATATGTGCCCCAACTCAAAAGTATTTCATGTTACCTGCGCACCATGTGGGTCCATGCGCGTGAAAAACACAAATGCTTACAATGCTCCCAGTCAAATCCGCGGTCTTAGGCGCCATGAGAGCGCGTACATAGTTCGAGACCTGGAGACCTGAATTACGATCCTACAAGGAAACTCTGCCCTTAAGAACCACGAGAACCACGAGACCATGCACCATAAT

Full Affymetrix probeset data:

Annotations for 1624758_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720