FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624761_at:

>probe:Drosophila_2:1624761_at:442:65; Interrogation_Position=2824; Antisense; ATGGATGATTATGCTCTACTCCGCC
>probe:Drosophila_2:1624761_at:369:271; Interrogation_Position=2861; Antisense; CATCCGATCCCAATCTGCAGAAAGG
>probe:Drosophila_2:1624761_at:579:215; Interrogation_Position=2892; Antisense; AAGATTCACGCCACAGCACGATGAT
>probe:Drosophila_2:1624761_at:169:247; Interrogation_Position=2965; Antisense; AATTCTCTGGAGGATGCACAGCACA
>probe:Drosophila_2:1624761_at:237:615; Interrogation_Position=3053; Antisense; TGAATACCAGCTCCGAGGCCTATGA
>probe:Drosophila_2:1624761_at:403:457; Interrogation_Position=3076; Antisense; GATAGTGGTCATGACTCCAACTCCA
>probe:Drosophila_2:1624761_at:593:437; Interrogation_Position=3105; Antisense; GAGGACTTCCAAACATTCGGGCATA
>probe:Drosophila_2:1624761_at:202:155; Interrogation_Position=3155; Antisense; ACAGTGTGGCCACCGTTAGGGATTC
>probe:Drosophila_2:1624761_at:252:57; Interrogation_Position=3182; Antisense; ATGAGAGTAGCTTCGCGTCCGGCAT
>probe:Drosophila_2:1624761_at:111:37; Interrogation_Position=3205; Antisense; ATGTCCAAGGGTCAACGGCATCGCA
>probe:Drosophila_2:1624761_at:291:45; Interrogation_Position=3224; Antisense; ATCGCATCACCGTTTCAGGAACAGG
>probe:Drosophila_2:1624761_at:508:151; Interrogation_Position=3256; Antisense; ACATCGGCGGGCATTGGAAATTACC
>probe:Drosophila_2:1624761_at:358:169; Interrogation_Position=3331; Antisense; AAAGGCCTCTGCAACTGGCTCTTGA
>probe:Drosophila_2:1624761_at:324:723; Interrogation_Position=3352; Antisense; TTGACACCATTTTCCTGCACTTATC

Paste this into a BLAST search page for me
ATGGATGATTATGCTCTACTCCGCCCATCCGATCCCAATCTGCAGAAAGGAAGATTCACGCCACAGCACGATGATAATTCTCTGGAGGATGCACAGCACATGAATACCAGCTCCGAGGCCTATGAGATAGTGGTCATGACTCCAACTCCAGAGGACTTCCAAACATTCGGGCATAACAGTGTGGCCACCGTTAGGGATTCATGAGAGTAGCTTCGCGTCCGGCATATGTCCAAGGGTCAACGGCATCGCAATCGCATCACCGTTTCAGGAACAGGACATCGGCGGGCATTGGAAATTACCAAAGGCCTCTGCAACTGGCTCTTGATTGACACCATTTTCCTGCACTTATC

Full Affymetrix probeset data:

Annotations for 1624761_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720