FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624762_at:

>probe:Drosophila_2:1624762_at:200:727; Interrogation_Position=1069; Antisense; TTGAGGAGCCCTCAATGGCGCCCAT
>probe:Drosophila_2:1624762_at:470:321; Interrogation_Position=1088; Antisense; GCCCATCGTGGTGGAGGAACAGCCC
>probe:Drosophila_2:1624762_at:488:199; Interrogation_Position=1164; Antisense; AACCGCTACTTCCTTAAGAAGCTGA
>probe:Drosophila_2:1624762_at:219:43; Interrogation_Position=597; Antisense; ATCGTGTTCATCAAGGCACCATCTG
>probe:Drosophila_2:1624762_at:358:571; Interrogation_Position=626; Antisense; GGCTATCCGTCAGCCAGTTGTGCCA
>probe:Drosophila_2:1624762_at:300:261; Interrogation_Position=649; Antisense; CACCACCACCCCAGAATGAGGAGAA
>probe:Drosophila_2:1624762_at:687:375; Interrogation_Position=671; Antisense; GAAGACTCTGATCTATGTGCTGCAC
>probe:Drosophila_2:1624762_at:44:683; Interrogation_Position=684; Antisense; TATGTGCTGCACAAGAAGCCCGAGC
>probe:Drosophila_2:1624762_at:413:111; Interrogation_Position=712; Antisense; AGCAAGATATCGTGATCCCGACGCC
>probe:Drosophila_2:1624762_at:416:131; Interrogation_Position=821; Antisense; ACCTGCAGAGATGGAGCCCCGTCAG
>probe:Drosophila_2:1624762_at:611:77; Interrogation_Position=856; Antisense; AGGATTTCGCTCCATTGGCTGAGGT
>probe:Drosophila_2:1624762_at:116:315; Interrogation_Position=923; Antisense; GCCGGAAGTAGAGCAGCCAGCCATT
>probe:Drosophila_2:1624762_at:606:143; Interrogation_Position=972; Antisense; ACTGCAGCTGCCTATACTGGTGAGG
>probe:Drosophila_2:1624762_at:387:509; Interrogation_Position=991; Antisense; GTGAGGAGGTTCAGACCACCTTGTC

Paste this into a BLAST search page for me
TTGAGGAGCCCTCAATGGCGCCCATGCCCATCGTGGTGGAGGAACAGCCCAACCGCTACTTCCTTAAGAAGCTGAATCGTGTTCATCAAGGCACCATCTGGGCTATCCGTCAGCCAGTTGTGCCACACCACCACCCCAGAATGAGGAGAAGAAGACTCTGATCTATGTGCTGCACTATGTGCTGCACAAGAAGCCCGAGCAGCAAGATATCGTGATCCCGACGCCACCTGCAGAGATGGAGCCCCGTCAGAGGATTTCGCTCCATTGGCTGAGGTGCCGGAAGTAGAGCAGCCAGCCATTACTGCAGCTGCCTATACTGGTGAGGGTGAGGAGGTTCAGACCACCTTGTC

Full Affymetrix probeset data:

Annotations for 1624762_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720