FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624763_at:

>probe:Drosophila_2:1624763_at:555:297; Interrogation_Position=1761; Antisense; CGCGTGGACTCATCGCCCAGTGGGA
>probe:Drosophila_2:1624763_at:69:45; Interrogation_Position=1772; Antisense; ATCGCCCAGTGGGAGAATCTGATCA
>probe:Drosophila_2:1624763_at:472:525; Interrogation_Position=1813; Antisense; GGGAACGGTCGAGGCGATCATCTAA
>probe:Drosophila_2:1624763_at:231:57; Interrogation_Position=1841; Antisense; ATGTGGGTCGGGTACCCTTGCAGAA
>probe:Drosophila_2:1624763_at:76:163; Interrogation_Position=1893; Antisense; AAAAACATACACACCAACGACCTGG
>probe:Drosophila_2:1624763_at:563:199; Interrogation_Position=1908; Antisense; AACGACCTGGTGCAGAGCAGACCAA
>probe:Drosophila_2:1624763_at:320:515; Interrogation_Position=1948; Antisense; GTGTCCACACTAACACACTTGATCC
>probe:Drosophila_2:1624763_at:611:643; Interrogation_Position=2037; Antisense; TCTTCACCTGCGAAAGCTGCTTATC
>probe:Drosophila_2:1624763_at:647:119; Interrogation_Position=2051; Antisense; AGCTGCTTATCAACGAATTAATCTT
>probe:Drosophila_2:1624763_at:182:719; Interrogation_Position=2116; Antisense; TTGCCTGTACTTAAAGCGATTTATA
>probe:Drosophila_2:1624763_at:127:655; Interrogation_Position=2152; Antisense; TAATGTGTACGTGAACTGTTCGAGA
>probe:Drosophila_2:1624763_at:250:163; Interrogation_Position=2191; Antisense; AAATAATTCTTCGTGTTTCCAGTGC
>probe:Drosophila_2:1624763_at:488:645; Interrogation_Position=2198; Antisense; TCTTCGTGTTTCCAGTGCGAGTACA
>probe:Drosophila_2:1624763_at:191:503; Interrogation_Position=2212; Antisense; GTGCGAGTACAGTCGACTTGCTTAT

Paste this into a BLAST search page for me
CGCGTGGACTCATCGCCCAGTGGGAATCGCCCAGTGGGAGAATCTGATCAGGGAACGGTCGAGGCGATCATCTAAATGTGGGTCGGGTACCCTTGCAGAAAAAAACATACACACCAACGACCTGGAACGACCTGGTGCAGAGCAGACCAAGTGTCCACACTAACACACTTGATCCTCTTCACCTGCGAAAGCTGCTTATCAGCTGCTTATCAACGAATTAATCTTTTGCCTGTACTTAAAGCGATTTATATAATGTGTACGTGAACTGTTCGAGAAAATAATTCTTCGTGTTTCCAGTGCTCTTCGTGTTTCCAGTGCGAGTACAGTGCGAGTACAGTCGACTTGCTTAT

Full Affymetrix probeset data:

Annotations for 1624763_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720