Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624765_at:

>probe:Drosophila_2:1624765_at:96:575; Interrogation_Position=123; Antisense; GGCGGCTCCTGCAATTGTATCAATT
>probe:Drosophila_2:1624765_at:725:11; Interrogation_Position=145; Antisense; ATTCAAAGCTCGCAACTTGTGGCCG
>probe:Drosophila_2:1624765_at:441:367; Interrogation_Position=179; Antisense; GAATCTGTCAGACGTCGGGTCTGCT
>probe:Drosophila_2:1624765_at:400:583; Interrogation_Position=210; Antisense; TGGCTCCACTTTGGTCCAGCAGGTG
>probe:Drosophila_2:1624765_at:170:615; Interrogation_Position=260; Antisense; TGAAGCGACGCTGCAAGGACTGCTA
>probe:Drosophila_2:1624765_at:144:75; Interrogation_Position=275; Antisense; AGGACTGCTACATCGTGGTGCGCCA
>probe:Drosophila_2:1624765_at:557:75; Interrogation_Position=299; Antisense; AGGAGCGCGGTTATGTCATCTGCCC
>probe:Drosophila_2:1624765_at:708:47; Interrogation_Position=329; Antisense; ATCCACGCCACAAGCAGATGTCGAT
>probe:Drosophila_2:1624765_at:9:443; Interrogation_Position=33; Antisense; GATGTCCCTGGCTAGTAGAATACTG
>probe:Drosophila_2:1624765_at:389:217; Interrogation_Position=370; Antisense; AAGTCGTGGATCCTGACGCACGCCA
>probe:Drosophila_2:1624765_at:661:553; Interrogation_Position=405; Antisense; GGAGCGCGGCTATTAGACCTAATTA
>probe:Drosophila_2:1624765_at:174:365; Interrogation_Position=50; Antisense; GAATACTGCAACAAGGTTCCCGCTT
>probe:Drosophila_2:1624765_at:672:539; Interrogation_Position=64; Antisense; GGTTCCCGCTTGTGGAATGGTCTCA
>probe:Drosophila_2:1624765_at:490:229; Interrogation_Position=79; Antisense; AATGGTCTCAGTGCCGCGCGTGGTT

Paste this into a BLAST search page for me
GGCGGCTCCTGCAATTGTATCAATTATTCAAAGCTCGCAACTTGTGGCCGGAATCTGTCAGACGTCGGGTCTGCTTGGCTCCACTTTGGTCCAGCAGGTGTGAAGCGACGCTGCAAGGACTGCTAAGGACTGCTACATCGTGGTGCGCCAAGGAGCGCGGTTATGTCATCTGCCCATCCACGCCACAAGCAGATGTCGATGATGTCCCTGGCTAGTAGAATACTGAAGTCGTGGATCCTGACGCACGCCAGGAGCGCGGCTATTAGACCTAATTAGAATACTGCAACAAGGTTCCCGCTTGGTTCCCGCTTGTGGAATGGTCTCAAATGGTCTCAGTGCCGCGCGTGGTT

Full Affymetrix probeset data:

Annotations for 1624765_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime