FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624768_at:

>probe:Drosophila_2:1624768_at:488:369; Interrogation_Position=192; Antisense; GAATGATTCCCACTAATCTGGGCAG
>probe:Drosophila_2:1624768_at:183:171; Interrogation_Position=288; Antisense; AAAGAGTGGCCGACGTCTACAGGCT
>probe:Drosophila_2:1624768_at:318:569; Interrogation_Position=355; Antisense; GGCAGGATCACGACATGGATTCTTT
>probe:Drosophila_2:1624768_at:364:589; Interrogation_Position=370; Antisense; TGGATTCTTTAGCAGCCTCAATGGC
>probe:Drosophila_2:1624768_at:531:227; Interrogation_Position=389; Antisense; AATGGCCATTATTCGGTGGTGCAGC
>probe:Drosophila_2:1624768_at:29:545; Interrogation_Position=436; Antisense; GGATATAGACCAGTATGCAGCCGAT
>probe:Drosophila_2:1624768_at:617:617; Interrogation_Position=451; Antisense; TGCAGCCGATATACTGGCGGGATAT
>probe:Drosophila_2:1624768_at:672:25; Interrogation_Position=474; Antisense; ATAGTTGCGAGGGTTCTCTGCCCAA
>probe:Drosophila_2:1624768_at:334:215; Interrogation_Position=497; Antisense; AAGATGTCGACCCTGATGCTCAAGC
>probe:Drosophila_2:1624768_at:727:207; Interrogation_Position=518; Antisense; AAGCTACAGCAACTGGACGGGTCTC
>probe:Drosophila_2:1624768_at:644:625; Interrogation_Position=642; Antisense; TGCCCTTTCCTCGAGTACTATGAAA
>probe:Drosophila_2:1624768_at:251:387; Interrogation_Position=663; Antisense; GAAAATTCTCCATCTCTCAAATTGT
>probe:Drosophila_2:1624768_at:572:611; Interrogation_Position=697; Antisense; TGAACTGTTTTGTGGTTTGTGCAAC
>probe:Drosophila_2:1624768_at:405:565; Interrogation_Position=751; Antisense; GGCAACGGCTTCGAATTTGGATCAA

Paste this into a BLAST search page for me
GAATGATTCCCACTAATCTGGGCAGAAAGAGTGGCCGACGTCTACAGGCTGGCAGGATCACGACATGGATTCTTTTGGATTCTTTAGCAGCCTCAATGGCAATGGCCATTATTCGGTGGTGCAGCGGATATAGACCAGTATGCAGCCGATTGCAGCCGATATACTGGCGGGATATATAGTTGCGAGGGTTCTCTGCCCAAAAGATGTCGACCCTGATGCTCAAGCAAGCTACAGCAACTGGACGGGTCTCTGCCCTTTCCTCGAGTACTATGAAAGAAAATTCTCCATCTCTCAAATTGTTGAACTGTTTTGTGGTTTGTGCAACGGCAACGGCTTCGAATTTGGATCAA

Full Affymetrix probeset data:

Annotations for 1624768_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720