Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624769_s_at:

>probe:Drosophila_2:1624769_s_at:452:27; Interrogation_Position=587; Antisense; ATACGTATTCGCCACAAACACTTTG
>probe:Drosophila_2:1624769_s_at:448:159; Interrogation_Position=600; Antisense; ACAAACACTTTGTCGCCGCTGTGTT
>probe:Drosophila_2:1624769_s_at:325:503; Interrogation_Position=611; Antisense; GTCGCCGCTGTGTTGCATAAGGAAA
>probe:Drosophila_2:1624769_s_at:272:697; Interrogation_Position=642; Antisense; TTTAAAACATTTTCAGCGCCGCTTT
>probe:Drosophila_2:1624769_s_at:557:321; Interrogation_Position=657; Antisense; GCGCCGCTTTTATGGGCGTCTAAAA
>probe:Drosophila_2:1624769_s_at:640:167; Interrogation_Position=707; Antisense; AAATGGCTGAAAGGCTTTACGCGGC
>probe:Drosophila_2:1624769_s_at:628:567; Interrogation_Position=729; Antisense; GGCAGCGGCCACTATTAATGTACTT
>probe:Drosophila_2:1624769_s_at:697:713; Interrogation_Position=762; Antisense; TTCATTTTGCGCTAGATGTGGCAGC
>probe:Drosophila_2:1624769_s_at:453:61; Interrogation_Position=777; Antisense; ATGTGGCAGCGTGAGAAGGTTCTTA
>probe:Drosophila_2:1624769_s_at:486:231; Interrogation_Position=813; Antisense; AATGCTGTCACGCACGACATTTTTT
>probe:Drosophila_2:1624769_s_at:248:163; Interrogation_Position=884; Antisense; AAATAACACTAAATGGGCTCACGAG
>probe:Drosophila_2:1624769_s_at:189:595; Interrogation_Position=897; Antisense; TGGGCTCACGAGTTAATCTTTGAAA
>probe:Drosophila_2:1624769_s_at:508:249; Interrogation_Position=918; Antisense; GAAAAAAGAATCACCTTGCCCCGAG
>probe:Drosophila_2:1624769_s_at:227:321; Interrogation_Position=935; Antisense; GCCCCGAGCAGTATGCAACACATAT

Paste this into a BLAST search page for me
ATACGTATTCGCCACAAACACTTTGACAAACACTTTGTCGCCGCTGTGTTGTCGCCGCTGTGTTGCATAAGGAAATTTAAAACATTTTCAGCGCCGCTTTGCGCCGCTTTTATGGGCGTCTAAAAAAATGGCTGAAAGGCTTTACGCGGCGGCAGCGGCCACTATTAATGTACTTTTCATTTTGCGCTAGATGTGGCAGCATGTGGCAGCGTGAGAAGGTTCTTAAATGCTGTCACGCACGACATTTTTTAAATAACACTAAATGGGCTCACGAGTGGGCTCACGAGTTAATCTTTGAAAGAAAAAAGAATCACCTTGCCCCGAGGCCCCGAGCAGTATGCAACACATAT

Full Affymetrix probeset data:

Annotations for 1624769_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime