FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624770_at:

>probe:Drosophila_2:1624770_at:154:217; Interrogation_Position=1003; Antisense; AAGTTCGTCTCACTCGTGGGTCTAC
>probe:Drosophila_2:1624770_at:502:517; Interrogation_Position=1018; Antisense; GTGGGTCTACTCTGCATGGCTATCC
>probe:Drosophila_2:1624770_at:594:67; Interrogation_Position=1033; Antisense; ATGGCTATCCTGATGCTCTGCATGG
>probe:Drosophila_2:1624770_at:357:691; Interrogation_Position=1112; Antisense; TTTGGAGACTGGGACTGGCTTTTCA
>probe:Drosophila_2:1624770_at:406:583; Interrogation_Position=1127; Antisense; TGGCTTTTCAGGCATTCGCAGGACT
>probe:Drosophila_2:1624770_at:543:319; Interrogation_Position=1179; Antisense; GGGCGAGGCCTTTCCCATAAAAGTG
>probe:Drosophila_2:1624770_at:380:511; Interrogation_Position=1201; Antisense; GTGAAGCCCTTCTTTGTGGGATACA
>probe:Drosophila_2:1624770_at:63:365; Interrogation_Position=1287; Antisense; GAATTTTTTCTACCACTACTATCTG
>probe:Drosophila_2:1624770_at:333:679; Interrogation_Position=1316; Antisense; TAGGTATCATTCTCCTTGTTGGCGT
>probe:Drosophila_2:1624770_at:281:117; Interrogation_Position=1392; Antisense; AGCTACCAAGCTATTCCAGAGATTG
>probe:Drosophila_2:1624770_at:325:213; Interrogation_Position=889; Antisense; AAGAGTGCTCTTCTGACCGAAGGAT
>probe:Drosophila_2:1624770_at:431:463; Interrogation_Position=911; Antisense; GATTCATTTCCTGTTGGCCAGTGAC
>probe:Drosophila_2:1624770_at:690:1; Interrogation_Position=945; Antisense; ATTGGTGCGTTTGTTGGGAGCCCTA
>probe:Drosophila_2:1624770_at:112:529; Interrogation_Position=960; Antisense; GGGAGCCCTAGTGGCCCAAGGATTC

Paste this into a BLAST search page for me
AAGTTCGTCTCACTCGTGGGTCTACGTGGGTCTACTCTGCATGGCTATCCATGGCTATCCTGATGCTCTGCATGGTTTGGAGACTGGGACTGGCTTTTCATGGCTTTTCAGGCATTCGCAGGACTGGGCGAGGCCTTTCCCATAAAAGTGGTGAAGCCCTTCTTTGTGGGATACAGAATTTTTTCTACCACTACTATCTGTAGGTATCATTCTCCTTGTTGGCGTAGCTACCAAGCTATTCCAGAGATTGAAGAGTGCTCTTCTGACCGAAGGATGATTCATTTCCTGTTGGCCAGTGACATTGGTGCGTTTGTTGGGAGCCCTAGGGAGCCCTAGTGGCCCAAGGATTC

Full Affymetrix probeset data:

Annotations for 1624770_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720