FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624771_at:

>probe:Drosophila_2:1624771_at:598:53; Interrogation_Position=1020; Antisense; ATGCATTTGCCAAGGTGTCGCCTAT
>probe:Drosophila_2:1624771_at:499:663; Interrogation_Position=1045; Antisense; TAAATCGCTATTTTCTTCGTCGGGA
>probe:Drosophila_2:1624771_at:660:555; Interrogation_Position=1067; Antisense; GGACGCGCCAAAGTTTCTATCGAGA
>probe:Drosophila_2:1624771_at:279:393; Interrogation_Position=1090; Antisense; GAAAGGACCTAGTTCGGTGCCTACA
>probe:Drosophila_2:1624771_at:444:179; Interrogation_Position=546; Antisense; AAAATGTTCTTGTATGTCTTCGCAT
>probe:Drosophila_2:1624771_at:208:283; Interrogation_Position=581; Antisense; CTGCATAAGCATTTTCGTCCATCAT
>probe:Drosophila_2:1624771_at:639:417; Interrogation_Position=638; Antisense; GAGCGTCTCGATGAATCTCATGCGT
>probe:Drosophila_2:1624771_at:32:729; Interrogation_Position=672; Antisense; TTGTCACCGACTTATGTGGACCATT
>probe:Drosophila_2:1624771_at:394:519; Interrogation_Position=687; Antisense; GTGGACCATTTTTCTACAAGCCTGA
>probe:Drosophila_2:1624771_at:47:379; Interrogation_Position=710; Antisense; GAAGCGTGCAATAAGGCTCCTGTAA
>probe:Drosophila_2:1624771_at:623:163; Interrogation_Position=781; Antisense; AAATCTTCCTAACCATCTTACATCT
>probe:Drosophila_2:1624771_at:423:43; Interrogation_Position=965; Antisense; ATCGACGACATCATTCGGGATTCCC
>probe:Drosophila_2:1624771_at:537:541; Interrogation_Position=982; Antisense; GGATTCCCGATGTTTTAACTCGTCT
>probe:Drosophila_2:1624771_at:678:145; Interrogation_Position=999; Antisense; ACTCGTCTGCGAAGCTGTTACATGC

Paste this into a BLAST search page for me
ATGCATTTGCCAAGGTGTCGCCTATTAAATCGCTATTTTCTTCGTCGGGAGGACGCGCCAAAGTTTCTATCGAGAGAAAGGACCTAGTTCGGTGCCTACAAAAATGTTCTTGTATGTCTTCGCATCTGCATAAGCATTTTCGTCCATCATGAGCGTCTCGATGAATCTCATGCGTTTGTCACCGACTTATGTGGACCATTGTGGACCATTTTTCTACAAGCCTGAGAAGCGTGCAATAAGGCTCCTGTAAAAATCTTCCTAACCATCTTACATCTATCGACGACATCATTCGGGATTCCCGGATTCCCGATGTTTTAACTCGTCTACTCGTCTGCGAAGCTGTTACATGC

Full Affymetrix probeset data:

Annotations for 1624771_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720